View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18287_low_18 (Length: 205)

Name: NF18287_low_18
Description: NF18287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18287_low_18
NF18287_low_18
[»] chr4 (1 HSPs)
chr4 (20-190)||(36281244-36281414)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 190
Target Start/End: Complemental strand, 36281414 - 36281244
Alignment:
Q  20 ttaatttgtcactttattttatatgactctgaaatttgaagcttctttgtcttattttgtaggcaacaatttatttgattcttgcaattggtttcttcgt 119  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36281414 ttaatttgtcactttattttatatgactctgaaatttgaagtttctttgtcttattttgtaggcaacaatttatttgattcttgcaattggtttcttcgt 36281315  T
Q  120 taatttcattgcctttgctgtcacaagacgtcattgctttctctatttggctgtttccttcattatctgtg 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  36281314 taatttcattgcctttgctgtcacaagacgtcattgctttctctatttggctgtttccttcattatttgtg 36281244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University