View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18287_high_16 (Length: 213)

Name: NF18287_high_16
Description: NF18287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18287_high_16
NF18287_high_16
[»] chr7 (2 HSPs)
chr7 (67-192)||(22638154-22638289)
chr7 (17-49)||(22638118-22638150)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 67 - 192
Target Start/End: Original strand, 22638154 - 22638289
Alignment:
Q  67 gtgacattggaacaaattagttaatgtaattattagtaatagataatgggtcaatttggtcaaatcatattaatattatccaa----------tatagtt 156  Q
    ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||           ||||||    
T  22638154 gtgacattggaacaaattagttaatgttattattagtaatagatcatgggtcaatttggtcaaatcatattaatattatccaagaatactttgcatagtt 22638253  T
Q  157 tgagtgagaaaatgaaaataaataaataaatgttga 192  Q
    ||||||||||||||||||||||||||||||||||||    
T  22638254 tgagtgagaaaatgaaaataaataaataaatgttga 22638289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 22638118 - 22638150
Alignment:
Q  17 taggtaacttttgatatctaatgagataattat 49  Q
    ||||||||||| |||||||||||||||||||||    
T  22638118 taggtaactttagatatctaatgagataattat 22638150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University