View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18280_low_11 (Length: 236)

Name: NF18280_low_11
Description: NF18280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18280_low_11
NF18280_low_11
[»] chr3 (1 HSPs)
chr3 (1-131)||(44034743-44034873)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 44034743 - 44034873
Alignment:
Q  1 atgcacaacccgacgcccttaaataatttatggttcaaatgttatgagacagacatatgaaggatgtccatcaaattcatcgtctcatacgaagaattta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||    
T  44034743 atgcacaacccgacgcccttaaataatttatggttcaaatgttatgagagagacatatgaaggatgtccatcaagttcatcgtctcatacgaagaattta 44034842  T
Q  101 caacctgcactttttaaaaacatagacatca 131  Q
    |||||||||||||||||||||||||||||||    
T  44034843 caacctgcactttttaaaaacatagacatca 44034873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University