View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18279_low_28 (Length: 219)

Name: NF18279_low_28
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18279_low_28
NF18279_low_28
[»] chr2 (1 HSPs)
chr2 (1-203)||(16559810-16560013)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 16560013 - 16559810
Alignment:
Q  1 gcaaagactgtgatagtaagtacgacaatgaagaggg-atgcaattatgttgttctggtgggcagctggtgtacaagacggagagggagtgtggctttgg 99  Q
    |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16560013 gcaaagactgtgatagtaagtacgacgatgaagaggggatgcaattatgttgttctggtgggcagctggtgtacaagacggagagggagtgtggctttgg 16559914  T
Q  100 agtcgtagtatgtcttgagtgcgacaatagtcacagagcgaatgtaacgacaaagaggctatgcaaatatggtgttcttgcatgcgccgagtgaatgaga 199  Q
    ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16559913 agtcgtagtatgtcttgagtgcgacaatagtcacagagcaaatgcaacgacaaagaggctatgcaaatatggtgttcttgcatgcgccgagtgaatgaga 16559814  T
Q  200 ggac 203  Q
    ||||    
T  16559813 ggac 16559810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University