View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18278_low_65 (Length: 249)

Name: NF18278_low_65
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18278_low_65
NF18278_low_65
[»] chr2 (1 HSPs)
chr2 (22-232)||(43457966-43458176)
[»] chr8 (1 HSPs)
chr8 (178-232)||(4500936-4500990)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 43458176 - 43457966
Alignment:
Q  22 ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43458176 ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga 43458077  T
Q  122 gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43458076 gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga 43457977  T
Q  222 tagtgttaatt 232  Q
    |||||||||||    
T  43457976 tagtgttaatt 43457966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4500936 - 4500990
Alignment:
Q  178 agaggaatggttcttccttttcaaccacttgcaatgtcttttgatagtgttaatt 232  Q
    ||||||||| |||| ||||| ||||||||||||||||| ||||| ||||||||||    
T  4500936 agaggaatgattctacctttccaaccacttgcaatgtcctttgagagtgttaatt 4500990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University