View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18278_low_61 (Length: 260)

Name: NF18278_low_61
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18278_low_61
NF18278_low_61
[»] chr8 (1 HSPs)
chr8 (10-240)||(38118870-38119100)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 38118870 - 38119100
Alignment:
Q  10 attatacttcaaaatgcaaacactatgaataaaaataatagtgagacacatccttggcatcttcatggacatgatttttgggtacttggatatggaaagg 109  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38118870 attatacttcaaaatgcaaacactatgaataaaaataacagtgagacacatccttggcatcttcatggacatgatttttgggtacttggatatggaaagg 38118969  T
Q  110 gaaagtttgatgcgaacaaagacccaaaaaattataatttggtgaaccccattatgaagaatactgtgccagtgcactcatttggttggactgctttgag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38118970 gaaagtttgatgcgaacaaagacccaaaaaattataatttggtgaaccccattatgaagaatactgtgccagtgcactcatttggttggactgctttgag 38119069  T
Q  210 gtttcgatcagataatcctggtgtgtgggct 240  Q
    |||||||||||||||||||||||| ||||||    
T  38119070 gtttcgatcagataatcctggtgtctgggct 38119100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University