View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18272_low_33 (Length: 230)

Name: NF18272_low_33
Description: NF18272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18272_low_33
NF18272_low_33
[»] chr4 (1 HSPs)
chr4 (1-220)||(32650614-32650829)
[»] chr5 (1 HSPs)
chr5 (23-84)||(5080091-5080153)
[»] chr2 (1 HSPs)
chr2 (23-65)||(33854332-33854374)
[»] scaffold0011 (1 HSPs)
scaffold0011 (29-84)||(208034-208090)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 32650829 - 32650614
Alignment:
Q  1 tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatggatctcagcatctcaattcgtttactctttcctttcatttatttgcattat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  32650829 tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatcgatctcagcatctcaattcgtttactctttcctttcatttattttcattat 32650730  T
Q  101 cgccgtgataaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttcagtacgttaatcattatgattgttcacg 200  Q
     |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||    
T  32650729 ggccgtgatgaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttca----gttaatcattatgattgttcacg 32650634  T
Q  201 ttctggtactttttcctttg 220  Q
    ||||||||||||||||||||    
T  32650633 ttctggtactttttcctttg 32650614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 5080091 - 5080153
Alignment:
Q  23 ccaccgctctcatctgcttcttcgatggatctca-gcatctcaattcgtttactctttccttt 84  Q
    |||| |||||||||||||||||| || ||||||| | |||||||||| | |||||||||||||    
T  5080091 ccactgctctcatctgcttcttctatcgatctcatgtatctcaattcctatactctttccttt 5080153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 33854332 - 33854374
Alignment:
Q  23 ccaccgctctcatctgcttcttcgatggatctcagcatctcaa 65  Q
    ||||| ||||||||||||||||| || ||||||||||||||||    
T  33854332 ccaccactctcatctgcttcttcaatcgatctcagcatctcaa 33854374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 208090 - 208034
Alignment:
Q  29 ctctcatctgcttcttcgatggatctca-gcatctcaattcgtttactctttccttt 84  Q
    ||||||||||||||||| || ||||||| | |||||||||| | |||||||||||||    
T  208090 ctctcatctgcttcttctattgatctcaggtatctcaattcctatactctttccttt 208034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University