View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18272_high_18 (Length: 348)

Name: NF18272_high_18
Description: NF18272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18272_high_18
NF18272_high_18
[»] chr5 (2 HSPs)
chr5 (14-132)||(6992424-6992542)
chr5 (179-325)||(6992590-6992728)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 14 - 132
Target Start/End: Original strand, 6992424 - 6992542
Alignment:
Q  14 gcagagatcaagaagaggaagaagtgctagaggtggtagtgctggtgttgagaagtttacggcgttgttgagttctataccggagtaggggtagtttcgg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6992424 gcagagatcaagaagaggaagaagtgctagaggtggtagtgctggtgttgagaagtttacggcgttgttgagttctataccggagtaggggtagtttcgg 6992523  T
Q  114 aaaaaatggttcatggtga 132  Q
    |||||||||||||||||||    
T  6992524 aaaaaatggttcatggtga 6992542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 179 - 325
Target Start/End: Original strand, 6992590 - 6992728
Alignment:
Q  179 gatgtagatttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaacttttctccgttttt 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||    
T  6992590 gatgtagatttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaact--------ttttt 6992681  T
Q  279 atttttagtcgatgcattttacacacaactacatagcttaatctatt 325  Q
     |||||| |||||||||||| ||||||||||||||||||||||||||    
T  6992682 ctttttaatcgatgcattttgcacacaactacatagcttaatctatt 6992728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University