View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18269_low_26 (Length: 220)

Name: NF18269_low_26
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18269_low_26
NF18269_low_26
[»] chr1 (1 HSPs)
chr1 (23-202)||(12919689-12919873)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 12919689 - 12919873
Alignment:
Q  23 ggcatacaggatcaagattcacgcctttttgttccagtcgccctctggttggcagaatgtcgcgggccagtcgccacaaaaagtttctagt-----acag 117  Q
    ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||      | |    
T  12919689 ggcatacaggatcaagaatcacgcctttttgttccagtcggcctctggttggcagaatgttgcgggccagtcgccacaaaaagtttctagtcctagcctg 12919788  T
Q  118 tttggagcatgcattttccagactgctctccaaagcctttggtcaatcatagaagaagcttcagggttctctctactgttgtcat 202  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||    
T  12919789 tttggagcatgcattttccagtctgctctccaaagcctttggtcactcaaagatgaagcttcagggttctctctactgttgtcat 12919873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University