View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18266_low_11 (Length: 285)

Name: NF18266_low_11
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18266_low_11
NF18266_low_11
[»] chr7 (2 HSPs)
chr7 (152-279)||(37605132-37605244)
chr7 (61-111)||(37605250-37605300)
[»] chr8 (1 HSPs)
chr8 (111-159)||(39303253-39303301)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 152 - 279
Target Start/End: Complemental strand, 37605244 - 37605132
Alignment:
Q  152 gtaaagatggaaaatgtactacacgtcagtatgcctctactaaaattgtgaaatctgaaaatgtatgtatgagacacatgcagctggttttgtcgtttag 251  Q
    |||||||||||||||| |||||||||| |||||||||||||||||||||               ||||||||||||||||||||||||||||||||||||    
T  37605244 gtaaagatggaaaatgcactacacgtcggtatgcctctactaaaattgt---------------atgtatgagacacatgcagctggttttgtcgtttag 37605160  T
Q  252 tatgggattcacgcacaggttctgctcg 279  Q
    |||||||||||||| ||||  |||||||    
T  37605159 tatgggattcacgctcaggccctgctcg 37605132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 61 - 111
Target Start/End: Complemental strand, 37605300 - 37605250
Alignment:
Q  61 ggataataaatgtattgaaattctagtccttcaatattaacaataattatt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  37605300 ggataataaatgtattgaaattctagtccttcaatattaacaataaatatt 37605250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 159
Target Start/End: Original strand, 39303253 - 39303301
Alignment:
Q  111 tattttcttataaggactaatccgataataagtaattactcgtaaagat 159  Q
    |||||||||||||||||||||  |||||||||||| ||||  |||||||    
T  39303253 tattttcttataaggactaatatgataataagtaaatactaataaagat 39303301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University