View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18262_low_6 (Length: 237)

Name: NF18262_low_6
Description: NF18262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18262_low_6
NF18262_low_6
[»] chr1 (1 HSPs)
chr1 (17-229)||(5202518-5202730)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 5202518 - 5202730
Alignment:
Q  17 caaatacatcgtcttcgcccacggcttcggcaccgaccaatcagcatggcagcgcgtgctcccttacttcacccgcagctataaagtcattctctatgac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5202518 caaatacatcgtcttcgcccacggcttcggcaccgaccaatcagcatggcagcgcgtgctcccttacttcacccgcagctataaagtcattctctatgac 5202617  T
Q  117 ctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacgcttacgttgatgacctcctcaacatccttgattccc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5202618 ctcgtttgcgccggcagtgtcaaccccgattacttcgattaccgccgctacacaactcttgacgcttacgttgatgacctcctcaacatccttgattccc 5202717  T
Q  217 ttcatctcactcg 229  Q
    | ||| |||||||    
T  5202718 tccatgtcactcg 5202730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University