View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18261_low_41 (Length: 204)

Name: NF18261_low_41
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18261_low_41
NF18261_low_41
[»] chr1 (1 HSPs)
chr1 (58-190)||(5402253-5402380)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 58 - 190
Target Start/End: Complemental strand, 5402380 - 5402253
Alignment:
Q  58 tatttgcatagatgtgttgtcatgtcaatactgaatagaatcgtccacataaagtgcgtatttgcttttgtcatccggtgaaaaccattcaaagcatgca 157  Q
    ||||||||||||||||||||||     ||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
T  5402380 tatttgcatagatgtgttgtca-----atactgaatagtatcgtccacataaagtgcgtatttgcttttgtcatatggtgaaaaccattcaaagcatgca 5402286  T
Q  158 tgcatgtatgctattcttctttcatataaatac 190  Q
    |||||||||||||||||||||||||||||||||    
T  5402285 tgcatgtatgctattcttctttcatataaatac 5402253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University