View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18261_low_37 (Length: 234)

Name: NF18261_low_37
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18261_low_37
NF18261_low_37
[»] chr5 (2 HSPs)
chr5 (118-219)||(4948978-4949081)
chr5 (23-81)||(4949118-4949176)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 118 - 219
Target Start/End: Complemental strand, 4949081 - 4948978
Alignment:
Q  118 tcgttgttgagtaaacttattgatgtagtagattaaat--tccttcaaatggttaattttgaatgattaaagcctgtcgtatgcttcccaggagatcctt 215  Q
    ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4949081 tcgttgttgagtaaacttattgatgtagtagattaaatattccttcaaatggttaattttggatgattaaagcctgtcgtatgcttcccaggagatcctt 4948982  T
Q  216 tgct 219  Q
    ||||    
T  4948981 tgct 4948978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 23 - 81
Target Start/End: Complemental strand, 4949176 - 4949118
Alignment:
Q  23 ctcccatcacagtaccttccttcatggatatagtaaccctagaatccttatcaaaggac 81  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  4949176 ctcccatcacaggaccttccttcatggatatagtaaccctagaatccttatcaaaggac 4949118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University