View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18261_high_37 (Length: 228)

Name: NF18261_high_37
Description: NF18261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18261_high_37
NF18261_high_37
[»] chr1 (1 HSPs)
chr1 (24-171)||(33903163-33903310)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 24 - 171
Target Start/End: Original strand, 33903163 - 33903310
Alignment:
Q  24 ggcagaccaagacaaagctcagtctccttcaggttcaaaccatgccccatagtggccatattccttttggctagtttctcaatgaaatccaaaccttaga 123  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||| |||| ||||||    
T  33903163 ggcagacccagacaaagctcagtctccttcaggttcaaaccatgccccatagtagccatattctttttggctagcttctcaatgaaatacaaagcttaga 33903262  T
Q  124 agaataagaagattgtagaatataattgaaaagatataatattgactc 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  33903263 agaataagaagattgtagaatataattgaaaagatataatattgactc 33903310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University