View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18260_high_6 (Length: 224)

Name: NF18260_high_6
Description: NF18260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18260_high_6
NF18260_high_6
[»] chr8 (1 HSPs)
chr8 (19-208)||(34626552-34626741)


Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 34626741 - 34626552
Alignment:
Q  19 actcagtatattccagttactcttcatatttaatttcgtattatcaatcaaggctccacttacatgatagaataaaattaaaattgtgtatacaaagtat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34626741 actcagtatattccagttactcttcatatttaatttcgtattatcaatcaaggctccacttacatgatagaataaaattaaaattgtgtatacaaagtat 34626642  T
Q  119 tggagaccccattaactcacacatcattggtgtgcacagtccagtaagcaatgaggaaagcatgcactgacagactaaatgtgataacaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34626641 tggagaccccattaactcacacatcattggtgtgcacagtccagtaagcaatgaggaaagcatgcactgacagactaaatgtgataacaa 34626552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University