View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18259_low_19 (Length: 228)

Name: NF18259_low_19
Description: NF18259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18259_low_19
NF18259_low_19
[»] chr6 (1 HSPs)
chr6 (56-217)||(31556825-31556986)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 217
Target Start/End: Original strand, 31556825 - 31556986
Alignment:
Q  56 atggatagtttcttaattgagaattcttaaaaaatacccataagacacttgtgaacaagaccctttaaaaaattatcagaaaaccaattacgaggataag 155  Q
    ||||||||||||||||||||||||||||||| | | ||| ||  |||||||| | |||||||||||||||||||||||||||| ||||||| ||||||||    
T  31556825 atggatagtttcttaattgagaattcttaaagagtgcccctataacacttgttagcaagaccctttaaaaaattatcagaaaatcaattaccaggataag 31556924  T
Q  156 tgtcatcattctctgccccacatttacttgaaaaagctttaaaccataaatccttcttctca 217  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  31556925 tgtcatcattctccgccccacatttacttgaaaaagctttaaaccataaatccttcttctca 31556986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University