View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18256_low_7 (Length: 223)

Name: NF18256_low_7
Description: NF18256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18256_low_7
NF18256_low_7
[»] chr5 (1 HSPs)
chr5 (12-207)||(10835852-10836047)


Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 10836047 - 10835852
Alignment:
Q  12 tgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattggaagatacataagagcaagaccagaagacca 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10836047 tgagaagaaattgaagaccataaccaacaagacccattgaagcagcaataaacatgacaagagagattggaagatacataagagcaagaccagaagacca 10835948  T
Q  112 accaaacactttacccatgtcacttgcagttgctaagtagttaagttgcacttgtgagattttgagtacggatttcattgttgatgagtatgatga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10835947 accaaacactttacccatgtcacttgcagttgctaagtagttaagttgcacttgtgagattttgagtacggatttcattgttgatgagtatgatga 10835852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University