View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18251_low_6 (Length: 408)
Name: NF18251_low_6
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18251_low_6 |
 |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
| [»] scaffold0001 (3 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0056 (5 HSPs) |
 |  |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0160 (3 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (3 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (3 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0210 (3 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (3 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 229)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 18 - 352
Target Start/End: Original strand, 3807583 - 3807919
Alignment:
| Q |
18 |
cctttatgtcgaggaattggaattttgtattaagaaaactcttgtacaaattggcatgctaaattggatgcatcgttttctcatgagtagatcacccaaa |
117 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807583 |
cctttatgtcgaggaattggaatgttgtgttaagaaaactcttgtacaaatcggcatgctaaattggatgcatcgttttctcatgagtagatcacccaaa |
3807682 |
T |
 |
| Q |
118 |
cttatccatctctcctcttgagatactttttagctcatgttaggataactttattctactgcctttag--nnnnnnnnccctcttttcttgttgccattg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
3807683 |
cttatccatctctcctcttgagatactttttagctcatgttaggataactttattctactgtctttagttttttttttccctcttttcttgttgccattg |
3807782 |
T |
 |
| Q |
216 |
tagtcgtcccattgataaaaataacacatgtttagtttttcttttacaaatacaaacatatgcattgaatttttatatctaggctaaaatttggttttgg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
3807783 |
tagtcgtcccattgataaaaataacacatgtttaggttttcttttacaaatacaaacatatgcattgcatttttatatctaggctaaaatatagttttgg |
3807882 |
T |
 |
| Q |
316 |
tccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3807883 |
ttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 296 - 392
Target Start/End: Original strand, 35104077 - 35104173
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctgactccacttttgtgatgatttgcacacgtggcacatgatg |
35104173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 297 - 393
Target Start/End: Original strand, 6589021 - 6589117
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||| |||| ||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccttggctccacttttgtgatgatttgcacacgtgacacatgatga |
6589117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 23399685 - 23399768
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
23399768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 23676205 - 23676288
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
23676288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 25988676 - 25988593
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
25988593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 26877751 - 26877834
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
26877834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 44568399 - 44568482
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
44568482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 3808111 - 3808023
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
3808111 |
tttgtttttggtccctgcaaatatgtctcgttttggttttagtctctgacctcacttttgtgatgatttgcacacgtgacacatgatga |
3808023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 8144585 - 8144502
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8144585 |
ttttggtccctgcaaatatgtctcattttggttttgatccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
8144502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 25092233 - 25092316
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| | |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgggtccacttttgtgataatttgcacacgtgtcacatgatga |
25092316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 27037860 - 27037777
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacatgtgtcacatgatga |
27037777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 29198376 - 29198459
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| | |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgggtccacttttgtgataatttgcacacgtgtcacatgatga |
29198459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31503710 - 31503627
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31503710 |
ttttggtccctgcaaatatgtctcattttagttttggtccctggctccacttttgtgataatttgtacacgtggcacatgatga |
31503627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 2945777 - 2945689
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2945777 |
tttgtttttggtccctaaaaatatgtctcgttttggttttggtccctggccccacttttgtgatgatttgcacacgtggcacatgatga |
2945689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5355045 - 5354962
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5355045 |
ttttggtccctgcaaatatgcttcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
5354962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 9659428 - 9659511
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
9659511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 16940835 - 16940918
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16940835 |
ttttggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
16940918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 27458472 - 27458555
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtgacacatgatga |
27458555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 30223534 - 30223617
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30223534 |
ttttggtccctgcaaatatgtttcattttggttttggtccctagctccacttttgtgatgatttgcacacgtggcacatgatga |
30223617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35837997 - 35838080
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35837997 |
ttttggtccctgtaaatatgtctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
35838080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 39520471 - 39520554
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39520471 |
ttttggtccctccaaatatatctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
39520554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 41054103 - 41054020
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacatgtggcacatgatga |
41054020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 300 - 393
Target Start/End: Complemental strand, 28529206 - 28529113
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||| || |||||| |||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggttttgatcactggctccacttttgtgatgatttgcacacgtgacacataatga |
28529113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 3975766 - 3975683
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtaatgatttgcacacgtggcacatgatga |
3975683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 5233881 - 5233964
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||||| |||||||||||||||||| |||| || |||||||||| |
|
|
| T |
5233881 |
ttttggtccctgcaaatatgtcccattttggttttggtccctggctccacttttgtgataatttgtacacatgtcacatgatga |
5233964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 35470207 - 35470124
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctggctctacttttgtgatgatttgcacacgtggcacatgatga |
35470124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 1614557 - 1614614
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1614557 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 25988383 - 25988440
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988383 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35838339 - 35838282
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35838339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 8144294 - 8144350
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 394
Target Start/End: Complemental strand, 19005865 - 19005781
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| || |||||| |||||| ||||||||| ||| ||||||||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtcccctgcctcacttctgtgatgatttgcacatgtgacacatgatgat |
19005781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 23399977 - 23399921
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25092159 - 25092215
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 27458398 - 27458454
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 35665943 - 35666031
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||| ||||||| | |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
35665943 |
tttgtttttggtccttgcaaatatgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcatacgtgacacatgatga |
35666031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 1271526 - 1271443
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||| || || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1271526 |
ttttagtccctgcaaatatgtctcgttttagttttggtctctagccccacttttgtgataatttgtacacgtggcacatgatga |
1271443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 11766990 - 11767073
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| | |||||||| ||| |||||||||| |||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11766990 |
ttttggtccttccaaatatgcctcattttggttttggtccctagctccacttttgtgatgatttgcacacgtggcacatgatga |
11767073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 38486720 - 38486637
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||| ||| ||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38486720 |
ttttggttcctgcaaatatgtctcgttttgattttggtctctgtccacacttttgtgatgatttgcacacgtggcacatgatga |
38486637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 39438956 - 39438873
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
39438956 |
ttttggtccctgcaaatatgtcttattttggttttggtccctgactccacttttgtgatgatttgcacatgtgacacatgatga |
39438873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 48852517 - 48852600
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| |||||||||| |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
48852517 |
ttttggtccctgcaaatatgcctcattttgattttggtccctggctccacttttgtgatgatttgcacatgtgacacatgatga |
48852600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 46759656 - 46759710
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759656 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 8144660 - 8144603
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 23399610 - 23399667
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23399610 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 23676130 - 23676187
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23676130 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 23676454 - 23676397
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23676454 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 26878073 - 26878016
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26878073 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 29198301 - 29198358
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29198301 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 29198664 - 29198607
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 35837923 - 35837976
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 39832904 - 39832961
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39832961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 48192490 - 48192433
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48192490 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 1614905 - 1614849
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 3975548 - 3975604
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 5234205 - 5234149
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 9659690 - 9659634
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 25988750 - 25988694
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 30223460 - 30223516
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 39439030 - 39438974
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 284 - 352
Target Start/End: Complemental strand, 41054249 - 41054181
Alignment:
| Q |
284 |
atttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41054249 |
atttttatttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 44344790 - 44344734
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
44344734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 44568691 - 44568635
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 45228919 - 45228863
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 46828943 - 46828999
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 310 - 394
Target Start/End: Complemental strand, 46829237 - 46829153
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||| ||||||| || |||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
46829237 |
ttttggttcctgcaaatatgccttgttttggttttggtccctgactccacttttgtgatgatttgcacacatgacacatgatgat |
46829153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 16853589 - 16853534
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 35210515 - 35210460
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 44841428 - 44841511
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || | | | |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
44841428 |
ttttggtccctgcaaatatgtctcgttttggttttggttcttaaccccacttttgtgatgatttggacacgtggcacatgatga |
44841511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 372
Target Start/End: Original strand, 1614632 - 1614694
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatt |
372 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggttttggtccctagctccacttttgtgataatt |
1614694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 3975840 - 3975786
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3975840 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 5354766 - 5354823
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5354766 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 6108333 - 6108390
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
6108390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 9659353 - 9659410
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9659353 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 14543709 - 14543762
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 17999723 - 17999666
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17999723 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
17999666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35104297 - 35104240
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35104297 |
taggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35470282 - 35470225
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35470282 |
taggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 44509055 - 44508998
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
44508998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 1006835 - 1006891
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
1006891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 5233807 - 5233863
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 12894403 - 12894347
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 13769774 - 13769826
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 19757747 - 19757803
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 20355488 - 20355572
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||| | | ||||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
20355488 |
ttttggtccttgcaaatatgtctcgttttggttttggtcatttgtctcacttttgtgatgatttgtacacgtgacacatgatgat |
20355572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 284 - 348
Target Start/End: Original strand, 23816658 - 23816721
Alignment:
| Q |
284 |
atttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
23816658 |
atttttatat-taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 25092549 - 25092493
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 26877677 - 26877733
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 28911907 - 28911851
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 39520397 - 39520453
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 44508720 - 44508776
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
44508776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 44568325 - 44568381
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 44958507 - 44958451
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 1974009 - 1974064
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 25547490 - 25547435
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25547435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 352
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 305 - 392
Target Start/End: Complemental strand, 37527354 - 37527267
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||| |||| ||| |||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
37527354 |
tttgttttaggtccctgcaaatatgtctcattttgattttggtctttggccccacttttgtgatgatttgcacacgtgacacatgatg |
37527267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 46829312 - 46829257
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 6892263 - 6892205
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
6892263 |
ctaggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 19783813 - 19783867
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19783813 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| |||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 35015222 - 35015164
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
35015222 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
35015164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 307 - 352
Target Start/End: Complemental strand, 1271589 - 1271544
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1271589 |
tggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 11767277 - 11767220
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11767277 |
taggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 12932785 - 12932728
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 20388272 - 20388329
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
20388272 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20388329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 28262711 - 28262768
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
28262711 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 28911575 - 28911632
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28911575 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
28911632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 30223796 - 30223743
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 30709646 - 30709593
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 39438739 - 39438792
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39438739 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 39719644 - 39719587
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
39719644 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 48852443 - 48852496
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 2945846 - 2945790
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 6509207 - 6509263
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 6509471 - 6509415
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 385
Target Start/End: Original strand, 6891962 - 6892042
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggca |
385 |
Q |
| |
|
|||| |||||||| ||||||||||| ||| |||||||||| ||||||| | |||||||||||| ||||||||| |||||| |
|
|
| T |
6891962 |
tttgtttttggtctctgcaaatatgcctcattttggttttggtccctgaccccacttttgtgatgatttgcacaggtggca |
6892042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 8555800 - 8555744
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 16940761 - 16940817
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 36684753 - 36684665
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| || |||||||||||||||||||||||||| ||| |||| |||||||||||| |||| ||||||| |||||||||| |
|
|
| T |
36684753 |
tttgtttttgatctctgcaaatatgtctcgttttggttttggtctctgggcccacttttgtgattatttaaacacgtgacacatgatga |
36684665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 37372905 - 37372849
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctg |
37372849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 39520727 - 39520675
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 41053841 - 41053897
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 45073642 - 45073586
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45073586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 288 - 352
Target Start/End: Original strand, 45228606 - 45228670
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||| ||||||||| ||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
45228606 |
ttatatataggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 48854071 - 48854015
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 230 - 281
Target Start/End: Original strand, 3810502 - 3810553
Alignment:
| Q |
230 |
ataaaaataacacatgtttagtttttcttttacaaatacaaacatatgcatt |
281 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| |||||||||||||||||||| |
|
|
| T |
3810502 |
ataaaaataacacatgtttattttttattttccaaatacaaacatatgcatt |
3810553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 5308323 - 5308378
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 301 - 348
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 10358368 - 10358313
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 21223749 - 21223694
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 39833236 - 39833181
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 298 - 349
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 46304384 - 46304329
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 324 - 394
Target Start/End: Complemental strand, 6847033 - 6846963
Alignment:
| Q |
324 |
aatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| ||||||||||| ||| ||| | |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
6847033 |
aatatgtctggttttggttttggtctctgaccccacttttgtgatgatttgcgcacgtggcacatgatgat |
6846963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 305 - 383
Target Start/End: Original strand, 6887228 - 6887306
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtgg |
383 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||||| ||||||| | ||||||||||| ||||| |||||||| |
|
|
| T |
6887228 |
tttgtttttggtccctacaaatatgtttcgttttggttttggtccctgacccaacttttgtgatgatttgtacacgtgg |
6887306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 18022706 - 18022652
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18022706 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 310 - 348
Target Start/End: Complemental strand, 38186747 - 38186709
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186747 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 307 - 348
Target Start/End: Complemental strand, 5355107 - 5355066
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5355107 |
tggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 10357999 - 10358056
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || | || ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10357999 |
taggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg |
10358056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 14739005 - 14738948
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctgg |
14738948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 19465982 - 19465926
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19465982 |
taggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg |
19465926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 21554755 - 21554698
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || |||||| |||||||||||| |
|
|
| T |
21554755 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctg |
21554698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 305 - 394
Target Start/End: Complemental strand, 22540225 - 22540136
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||| |||| ||| ||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22540225 |
tttgtttttggtctctgtaaatatgtctcgttttgattttggtctctgatcccacttttgtgatgatttgcacatttggcacatgatgat |
22540136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 393
Target Start/End: Original strand, 24717227 - 24717324
Alignment:
| Q |
297 |
ggctaaaatttggtttt-ggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||| |||||||| ||||||||||| ||||| |||| ||||||| ||||||||| || |||||||||| || |||||||||| |
|
|
| T |
24717227 |
ggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctgctcccacttttgtaatgatttgcacacatgacacatgatga |
24717324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 353
Target Start/End: Original strand, 30352563 - 30352616
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctgg |
30352616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 31310363 - 31310416
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtc |
31310416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 35210180 - 35210237
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || ||||| |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
35210180 |
taggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 35665875 - 35665932
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35665875 |
taggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 392
Target Start/End: Complemental strand, 37159906 - 37159813
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
||||||| || ||||||| |||||||||||| ||||||||||||| |||||| | ||||||||||| ||||||||||||| || |||||| |
|
|
| T |
37159906 |
ctaaaatatgattttggtttctgcaaatatgtttcgttttggttttgttccctgacgcaacttttgtgatgatttgcacacgtgtcatatgatg |
37159813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 45073312 - 45073369
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
45073312 |
taggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 489073 - 489017
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| ||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 1559706 - 1559650
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctg |
1559650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 13770082 - 13770026
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 30352904 - 30352848
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
30352848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 31503423 - 31503475
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 31503780 - 31503732
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtc |
31503732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 38186369 - 38186421
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 38486476 - 38486528
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 44402959 - 44403015
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgtttt-ggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 45021858 - 45021806
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45021858 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 341 - 393
Target Start/End: Original strand, 45228688 - 45228740
Alignment:
| Q |
341 |
ttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
45228688 |
ttttggtccctggctccatttttgtgatgatttgcacacgtggcacatgatga |
45228740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 31732101 - 31732156
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 318 - 393
Target Start/End: Complemental strand, 38186681 - 38186606
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| | ||||| |||| |||||| || ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
38186681 |
cctgcaaatatgcttaattttgattttggtccctagcctcacttttgtgatgatttgcacacgtgacacatgatga |
38186606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 41364884 - 41364939
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| || || ||||||||||||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg |
41364939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 22539928 - 22539985
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||| ||||||||||||| |||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 28263069 - 28263016
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctg |
28263016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 305 - 394
Target Start/End: Original strand, 34877842 - 34877930
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||| |||| ||||| ||||||| |||||||||||||| |||| || | |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
34877842 |
tttgtttttagtcccaacaaatatacctcgttttggttttggtcc-tgaccccacttttgtgatgatttgcacacgcggcacatgatgat |
34877930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 38486792 - 38486739
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| |||||||| |||||| ||||||| | |||||||||||||||| |
|
|
| T |
38486792 |
taggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg |
43058805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 45671212 - 45671269
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||| |||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
45671212 |
taggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 46304085 - 46304138
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 1559342 - 1559398
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 5308687 - 5308632
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctg |
5308632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| || |||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 23817035 - 23816979
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||| ||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 25547251 - 25547303
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25547251 |
taggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 45671550 - 45671494
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||| |||||| ||||||| ||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
45671550 |
taggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 393
Target Start/End: Complemental strand, 46759869 - 46759817
Alignment:
| Q |
341 |
ttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| || |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
46759869 |
ttttggtccctgactccacttttgtgatgatttgcacacgtgacacatgatga |
46759817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 350
Target Start/End: Original strand, 20355406 - 20355461
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||||| || ||||| ||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
20355406 |
taggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 393
Target Start/End: Complemental strand, 28262992 - 28262922
Alignment:
| Q |
323 |
aaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||| ||||| ||| |||| |||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
28262992 |
aaatatgtcccgttttagttttggtctctggtcccacttttgtgatgatttgcacacgtgacacataatga |
28262922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 338
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 352
Target Start/End: Complemental strand, 3954172 - 3954139
Alignment:
| Q |
319 |
ctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
3954172 |
ctgcatatatgtctcgttttggttttagtccctg |
3954139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 348
Target Start/End: Original strand, 6887174 - 6887211
Alignment:
| Q |
311 |
tttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
6887174 |
tttggtccttgcaaatatgtcttgttttggttttagtc |
6887211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 6911081 - 6911134
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || ||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 352
Target Start/End: Original strand, 12894059 - 12894096
Alignment:
| Q |
315 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
12894059 |
gtccctgcaaatatgcctcgttttggttttaatccctg |
12894096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 352
Target Start/End: Complemental strand, 19758041 - 19758004
Alignment:
| Q |
315 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19758041 |
gtccctgcaaatatgcctcattttggttttagtccctg |
19758004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| || |||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 35212067 - 35212124
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| | |||| |||||| |||||||| |
|
|
| T |
35212067 |
aggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctgg |
35212124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 36684534 - 36684583
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| ||| |||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
36684534 |
aggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||| ||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| ||||||| || || ||||||||||||||||| ||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 343
Target Start/End: Original strand, 488724 - 488760
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
488724 |
tggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 341 - 393
Target Start/End: Original strand, 14543782 - 14543834
Alignment:
| Q |
341 |
ttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| || ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
14543782 |
ttttggtccctgtctcaacttttgtgatgatttgcacacgtgacacatgatga |
14543834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 345
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 8e-37; HSPs: 267)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 292 - 394
Target Start/End: Original strand, 4211556 - 4211658
Alignment:
| Q |
292 |
atctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4211556 |
atctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctggccccacttttgtgatgatttgcacacgtggcacatgat |
4211655 |
T |
 |
| Q |
392 |
gat |
394 |
Q |
| |
|
||| |
|
|
| T |
4211656 |
gat |
4211658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 29499473 - 29499390
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
29499390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 30060842 - 30060925
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
30060925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 2034781 - 2034698
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccccggctccacttttgtgatgatttgcacacgtggcacatgatga |
2034698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 35464309 - 35464226
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
35464226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 53915756 - 53915839
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
53915839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 296 - 394
Target Start/End: Complemental strand, 14791807 - 14791709
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| || ||| ||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgaccccacttttgtgatgatttgcacacttgacacttgatgat |
14791709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 51738413 - 51738315
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||||| |||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51738413 |
taggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
51738315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 296 - 393
Target Start/End: Original strand, 29380667 - 29380764
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctggccccacttttgtaatgatttgcacacgtggcacatgatga |
29380764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 297 - 393
Target Start/End: Original strand, 46292392 - 46292488
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgcccccacttttgtgatgatttgcacacgtgacacatgatga |
46292488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 13631526 - 13631443
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13631526 |
ttttggtccctgcaaatatgtctcattttggttttgatcactggctccacttttgtgataatttgcacacgtggcacatgatga |
13631443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 24774354 - 24774271
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
24774271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 26412511 - 26412428
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtgtcacatgatga |
26412428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 42848318 - 42848235
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtgtcacatgatga |
42848235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 47135851 - 47135934
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
47135934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 7642585 - 7642497
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| ||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7642585 |
tttgtttttggtccctgcaaatatgtctcattttggttttggtccctgaccccacttttgtgatgatttgcacacgtggcacatgatga |
7642497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 36050354 - 36050442
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
36050354 |
tttgtttttggtccctgcaaatatgcctcgttttggttttggtccctggccccacttttgtgatgatttgcacacgtggcatatgatga |
36050442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 313 - 393
Target Start/End: Complemental strand, 54208749 - 54208669
Alignment:
| Q |
313 |
tggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54208749 |
tggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
54208669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5797747 - 5797664
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
5797664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 13530452 - 13530535
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
13530535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 19321643 - 19321726
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || |||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19321643 |
ttttggtccctgcaaatatgtctcattttggttttggttcctgactccacttttgtgataatttgcacacgtgacacatgatga |
19321726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 23245304 - 23245387
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacatgtcacatgatga |
23245387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 25424239 - 25424156
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
25424156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 31560404 - 31560487
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgtacacgtgtcacatgatga |
31560487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 46115706 - 46115623
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46115706 |
ttttggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
46115623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 46128840 - 46128757
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46128840 |
ttttggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
46128757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 25358501 - 25358413
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| | ||||||| | |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
25358501 |
tttggttttagtccctgcaaatatgtctcgttttggttgtggtccctgaccccacttttgtgatgatttgaacacgtggcacatgatga |
25358413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 31811991 - 31812079
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||| |||||||||| ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
31811991 |
tttgtttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttatgatgatttgcacacgtgacacatgatga |
31812079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 313 - 393
Target Start/End: Complemental strand, 47023029 - 47022949
Alignment:
| Q |
313 |
tggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
47023029 |
tggtccctgcaaatatgcctcattttggttttggtccctggctccacttttttgatgatttgcacacgtggcacatgatga |
47022949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 13073833 - 13073916
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
13073833 |
ttttggtccctgcaaatatatctcgttttggttttcgtctctggccccacttttgtgatgatttgcacacgtggtacatgatga |
13073916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 19903334 - 19903417
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19903334 |
ttttgatccctgcaaatatgtctcattttggttttggtccctggccacacttttgtgatgatttgcacatgtggcacatgatga |
19903417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 51763129 - 51763046
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtgacaaatgatga |
51763046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13631226 - 13631283
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13631226 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 305 - 394
Target Start/End: Original strand, 20144487 - 20144576
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
20144487 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccctgatcccacttttgtgatgatatgcacacgtggtacatgatgat |
20144576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 294 - 351
Target Start/End: Complemental strand, 29420540 - 29420483
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420540 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 35464016 - 35464073
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35464016 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 390
Target Start/End: Complemental strand, 2322359 - 2322279
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatga |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2322359 |
ttttggtccctgcaaatatgtctcgttttggttttcgtctctggccctacttttgtgatgatttgcacacgtgacacatga |
2322279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 8905167 - 8905079
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||| |||| || ||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
8905167 |
tttgtttttggtccctgcaaatatgtctcgttttggttttcgtccatggccccatttttgtgatgatttgcacacgtgacacataatga |
8905079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 292 - 352
Target Start/End: Original strand, 13073754 - 13073814
Alignment:
| Q |
292 |
atctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13073754 |
atcttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 14594499 - 14594411
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||| || |||||||||||| || || | |||||||||||||||| |
|
|
| T |
14594499 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgatgtgtagacgtggcacatgatga |
14594411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25423923 - 25423979
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 25424313 - 25424257
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 43231087 - 43231143
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5203220 - 5203137
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||| |||||| |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
5203220 |
ttttggtccctgcaaatatgcctcattttggttttggtctctggctccacttttgtgatgatttgcacatgtgacacatgatga |
5203137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 12791901 - 12791818
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| ||||||| | ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
12791901 |
ttttggcccctgcaaatatgcatcgttttggttttggtccctgacctcacttttgtgatgatttgcacacgtgacacatgatga |
12791818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 9289264 - 9289322
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
9289322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 12152496 - 12152438
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12152496 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 13479614 - 13479556
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479614 |
ctaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 23245598 - 23245540
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23245598 |
ctaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 46088062 - 46088004
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 11693123 - 11693066
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11693123 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 14488189 - 14488132
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14488189 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 26412188 - 26412245
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26412188 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 53916049 - 53915992
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53916049 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 5827974 - 5827918
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 293 - 353
Target Start/End: Complemental strand, 9289643 - 9289583
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9289643 |
tctaggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
9289583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 13530714 - 13530658
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 13631600 - 13631544
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 24774044 - 24774100
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 29499181 - 29499237
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 30046793 - 30046737
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 30061134 - 30061078
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 31812214 - 31812158
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 42848026 - 42848082
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 43231390 - 43231334
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 50714565 - 50714509
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
50714509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 5827655 - 5827710
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 5827728 - 5827811
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||| ||||||| | |||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
5827728 |
ttttgatccctgaaaatatgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcatatgtggcacatgatga |
5827811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 11692834 - 11692917
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||| | |||||||||||| |||| || |||||||||||||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctgaccccacttttgtgatgattttcatacgtggcacatgatga |
11692917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 352
Target Start/End: Original strand, 14487798 - 14487857
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
14487798 |
tctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 14488114 - 14488031
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||| | || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
14488114 |
ttttggtccctgcaaatatgcttcattttggttttggtccctgacaccaattttgtgatgatttgcacacgtggcacatgatga |
14488031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 19321859 - 19321804
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 24474964 - 24474909
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 31560695 - 31560640
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 46115414 - 46115469
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 46128548 - 46128603
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 312 - 391
Target Start/End: Original strand, 53307829 - 53307908
Alignment:
| Q |
312 |
ttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||| | ||||||||||||| |||| |||||||| || ||||| |
|
|
| T |
53307829 |
ttggtccctgcaaatatgtctcgttttggttttcgtctctgacctcacttttgtgatgatttacacacgtgacatatgat |
53307908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 53308068 - 53308013
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 299 - 349
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 35763645 - 35763703
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35763645 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
35763703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13530377 - 13530434
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13530377 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 29380911 - 29380858
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 34361802 - 34361855
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 41345852 - 41345909
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
41345909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 42823774 - 42823831
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 47023107 - 47023050
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47023107 |
taggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 51738135 - 51738192
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
51738135 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg |
51738192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 52430102 - 52430045
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52430102 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 52441761 - 52441818
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52441761 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
52441818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 53915681 - 53915738
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
53915681 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 387
Target Start/End: Complemental strand, 55805015 - 55804938
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcaca |
387 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
55805015 |
ttttggtccctgcaaatatgcatcattttggttttggtcgttggctccacttttgtgatgatttgcacacgtggcaca |
55804938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 2322433 - 2322377
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 317 - 393
Target Start/End: Complemental strand, 6353558 - 6353482
Alignment:
| Q |
317 |
ccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||| |||||| ||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
6353558 |
ccctgcaaatatgcctcattttggttttggtctctggctccacttttgttatgatttgcacatgtggcacatgatga |
6353482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 13064466 - 13064410
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 16712692 - 16712636
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16712636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 22099913 - 22099861
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 26314063 - 26314131
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||| || || |||||||||||| ||||||||| |
|
|
| T |
26314063 |
ttttggtccctgaaaatatgtctcgttttggttttggtccatgactccacttttgtgatgatttgcaca |
26314131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 26314333 - 26314277
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 31811924 - 31811980
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31811924 |
aggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 32365484 - 32365428
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 35415633 - 35415577
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
35415577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 36701999 - 36702055
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 46115780 - 46115724
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 46128914 - 46128858
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 288 - 352
Target Start/End: Complemental strand, 51545978 - 51545914
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| |||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51545978 |
ttatatataggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51545914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 52017504 - 52017560
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 52017871 - 52017815
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 52442093 - 52442037
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 289 - 349
Target Start/End: Original strand, 53716913 - 53716973
Alignment:
| Q |
289 |
tatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
53716913 |
tatatataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 54208822 - 54208774
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 54903476 - 54903420
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 9836896 - 9836979
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||||| ||||||| |||| ||||||| | ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
9836896 |
ttttggtccctacaaatatgtcacgttttgattttggtccctgtccccacttttatgatgatttgcacacgtgtcacatgatga |
9836979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 12152420 - 12152337
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| ||| ||| | |||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
12152420 |
ttttggttcctgcaaatatgtttcgttttggttttggtctctgaccccacttttgtgatgatttgcactcgtggcacacgatga |
12152337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 18205155 - 18205210
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 32208541 - 32208596
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 349
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 50754182 - 50754100
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| | |||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
50754182 |
tttttgtccctgcaaatatgtcttgttttggttttggtccctgaccccacttttgtgatgattt-cacacgtgacacatgatga |
50754100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 53717174 - 53717119
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 305 - 376
Target Start/End: Complemental strand, 54903408 - 54903337
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgca |
376 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||| | |||||||||||| ||||||| |
|
|
| T |
54903408 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccctctccccacttttgtgatgatttgca |
54903337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 123532 - 123590
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
123532 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgg |
123590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 351
Target Start/End: Original strand, 11692758 - 11692816
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| | ||||||| ||||||||||| |
|
|
| T |
11692758 |
tctaggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 13074127 - 13074073
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13074127 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 14594204 - 14594258
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14594204 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 35119613 - 35119559
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
35119613 |
taggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 41346220 - 41346166
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 41619897 - 41619955
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
41619955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 51708691 - 51708749
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgg |
51708749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 4279020 - 4279077
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4279020 |
taggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 291 - 352
Target Start/End: Original strand, 5797475 - 5797536
Alignment:
| Q |
291 |
tatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| || |||||| || |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5797475 |
tatcttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 5797822 - 5797765
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5797822 |
taggttaaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 6827875 - 6827818
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgg |
6827818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 12152152 - 12152209
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12152152 |
taggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 12791976 - 12791919
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12791976 |
taggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13064157 - 13064214
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
13064157 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
13064214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 351
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 13764808 - 13764755
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 300 - 353
Target Start/End: Original strand, 15555506 - 15555559
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
15555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 20291984 - 20292037
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 394
Target Start/End: Complemental strand, 20292250 - 20292161
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| |||| |||||||||| ||| |||| |||| ||| ||| || |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
20292250 |
tttggttttagtccatgcaaatatgcctcattttaattttggtctctgactccacttttgtgatgatttgcacacgtgacacatgatgat |
20292161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 22584285 - 22584338
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
22584285 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 30060767 - 30060824
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30060767 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 32365092 - 32365149
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32365092 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 43368467 - 43368520
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
43368520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 387
Target Start/End: Complemental strand, 44925770 - 44925693
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcaca |
387 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||| |||| |||||||||||| |||||||||||||||||| |
|
|
| T |
44925770 |
ttttggtccctgcaaatatgcctaattttggttttggtctatggcgccacttttgtgatgatttgcacacgtggcaca |
44925693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 45593588 - 45593531
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45593588 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 2034856 - 2034800
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2180219 - 2180275
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 8760603 - 8760659
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 8760782 - 8760726
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 23779226 - 23779170
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 29463914 - 29463858
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctg |
29463858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 31182198 - 31182282
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| || ||| | ||||||||| || ||||||||||||| ||||||||||| |
|
|
| T |
31182198 |
ttttggtccctgcgaatatgtctcattttggttttgatctctgaccccacttttgtaatgatttgcacacgtgacacatgatgat |
31182282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 31560330 - 31560386
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 35119291 - 35119347
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 318 - 378
Target Start/End: Original strand, 35420474 - 35420534
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||| |||||||||||| ||||||||| |
|
|
| T |
35420474 |
cctgcaaatatgtctcattttggttttggtccttggctccacttttgtgatgatttgcaca |
35420534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 36054151 - 36054095
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 38054549 - 38054601
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38054601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 42824091 - 42824039
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 45505599 - 45505655
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 45505895 - 45505839
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 50714240 - 50714296
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgg |
50714296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 55072388 - 55072444
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 26313988 - 26314043
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 27008084 - 27008139
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 28809011 - 28809066
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 28809181 - 28809126
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 290 - 353
Target Start/End: Complemental strand, 35763962 - 35763899
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||| ||||||||||| || |||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35763962 |
atatataggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctgg |
35763899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 41324890 - 41324835
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 393
Target Start/End: Complemental strand, 42824014 - 42823935
Alignment:
| Q |
314 |
ggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||| ||||| || ||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
42824014 |
ggtccctgcacatatgtctcgttttgattttggtctctggccccatttttgtgatgatttgcacatgtgacacatgatga |
42823935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 52543656 - 52543573
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| |||| |||| || | ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
52543656 |
tttttgtccctgcaaatatgtctcattttgattttggtccatgaccccacttttctgatgatttgcacacgtgtcacatgatga |
52543573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 310 - 352
Target Start/End: Original strand, 2034552 - 2034594
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2034552 |
ttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 35415297 - 35415355
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
35415297 |
taggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctgg |
35415355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 352
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 5052585 - 5052532
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 5882550 - 5882606
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
5882550 |
taggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 6827545 - 6827602
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctgg |
6827602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 19321568 - 19321625
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 19903259 - 19903316
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | |||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19903259 |
taggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctg |
19903316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 287 - 352
Target Start/End: Original strand, 20144410 - 20144475
Alignment:
| Q |
287 |
tttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || | |||||| ||||||||||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
20144410 |
tttatatttacgttaaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 22584609 - 22584552
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
22584609 |
taggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg |
22584552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 34355285 - 34355228
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34355285 |
taggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 41620257 - 41620200
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctgg |
41620200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 41921085 - 41921032
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 51709028 - 51708971
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgg |
51708971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 55072714 - 55072657
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
55072714 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcg-ttttggttttagtccct |
351 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 27427871 - 27427926
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 28197208 - 28197124
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg-gcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||| || || ||||||| |||| ||||| ||||||| |||||||||| |
|
|
| T |
28197208 |
ttttggtccctgcaagtatgtctcgttttggttttggtctatgacctccacttttatgatgatttgtacacgtgacacatgatga |
28197124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 31182505 - 31182449
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| | |||||||||||||||||||||||||| |||||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 46292652 - 46292600
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 51545628 - 51545680
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 298 - 345
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 7642652 - 7642597
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || || ||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctg |
7642597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 8191391 - 8191336
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 9446323 - 9446268
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctg |
9446268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 285 - 348
Target Start/End: Original strand, 28448822 - 28448885
Alignment:
| Q |
285 |
tttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| | |||||||||||| ||||||| |||| | |||||||| |||||||||||||||||| |
|
|
| T |
28448822 |
tttttaaaactaggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 32208902 - 32208847
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 41439861 - 41439944
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| || ||||| | |||||||||||||| | || || | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41439861 |
ttttggtccttgtaaataagcctcgttttggttttggcccatgaccctacttttgtgatgatttgcacacgtggcacatgatga |
41439944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 305 - 344
Target Start/End: Original strand, 43231187 - 43231226
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43231187 |
tttggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 55482468 - 55482413
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg |
55482413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 302 - 352
Target Start/End: Complemental strand, 27008401 - 27008351
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
27008351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| || |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 310 - 352
Target Start/End: Original strand, 43231161 - 43231203
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
43231203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| | ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 20144732 - 20144683
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 45593226 - 45593283
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | ||||| |||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
45593226 |
taggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg |
45593283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| | ||||| ||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg |
51830944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 350
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||| ||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 2180572 - 2180520
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 37557122 - 37557050
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtg |
382 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||| |||| | | ||||||||||||| ||||||||||||| |
|
|
| T |
37557122 |
ttttggtccctccaaatgtgcatcgttttggttttggtcctagtcctcacttttgtgatgatttgcacacgtg |
37557050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 393
Target Start/End: Original strand, 43200035 - 43200126
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||| ||||||||| |||||||||| ||| |||||||||| || ||| || |||||||||||| ||||||||| ||| || ||||||| |
|
|
| T |
43200035 |
aaaaattgtttttggtcc-tgcaaatatgcctcattttggttttgatctctgactccacttttgtgatgatttgcacatgtgacatatgatga |
43200126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 45474597 - 45474545
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 51762869 - 51762925
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
51762869 |
aggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg |
51762925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 8905234 - 8905180
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||| ||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 393
Target Start/End: Complemental strand, 11219753 - 11219696
Alignment:
| Q |
335 |
ttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||| |||||| |||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
11219753 |
ttttggttttcgtctctggctccacttttgtgatgatttacacacgt-gcacatgatga |
11219696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 335 - 393
Target Start/End: Complemental strand, 11230260 - 11230203
Alignment:
| Q |
335 |
ttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||| |||||| |||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
11230260 |
ttttggttttcgtctctggctccacttttgtgatgatttacacacgt-gcacatgatga |
11230203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 344
Target Start/End: Complemental strand, 30565125 - 30565091
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
30565125 |
ttttggtccctgcaaatatgtctcgttttgatttt |
30565091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 294 - 352
Target Start/End: Original strand, 37556838 - 37556896
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| ||||||| | || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
37556838 |
ctaggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 348
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 24474599 - 24474651
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 50754258 - 50754201
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| || ||||||| || | |||||| |||||||||||||| |
|
|
| T |
50754258 |
taggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctg |
50754201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 352
Target Start/End: Original strand, 54208479 - 54208516
Alignment:
| Q |
315 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
54208479 |
gtccctgcaaatatgcctcattttggttttagtccctg |
54208516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 352
Target Start/End: Complemental strand, 18136094 - 18136058
Alignment:
| Q |
316 |
tccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18136094 |
tccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 22204055 - 22204111
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| || ||||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctgg |
22204111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 345
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 31370802 - 31370854
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| || |||| |||||| ||||||||||||||||| |
|
|
| T |
31370802 |
taggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 32365200 - 32365248
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
||||||||||| || ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
32365200 |
tagtccctggccccatttttgtgatgatttgcatacgtggcacatgatg |
32365248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 34355070 - 34355114
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
34355070 |
tagtccctggccccacttttgtgatgatttgcatacgtggcacat |
34355114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 393
Target Start/End: Original strand, 35119383 - 35119419
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35119383 |
cacttttgtgatgatttgcacacgtggtacatgatga |
35119419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 35415406 - 35415450
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||||||||||| |
|
|
| T |
35415406 |
tagtccctgactccacttttgtgatgatttgcatacgtggcacat |
35415450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 41620149 - 41620105
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||||||||||| |
|
|
| T |
41620149 |
tagtccctgactccacttttgtgatgatttgcatacgtggcacat |
41620105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 287 - 347
Target Start/End: Original strand, 41920758 - 41920818
Alignment:
| Q |
287 |
tttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||| |||| || |||||| ||||||| ||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
41920758 |
tttaaatcttggttaaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 316 - 352
Target Start/End: Complemental strand, 49123302 - 49123266
Alignment:
| Q |
316 |
tccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
49123302 |
tccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 50822295 - 50822239
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||||| | ||| |||||||||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctg |
50822239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| | |||||||| | |||||||||| || |||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 5e-35; HSPs: 285)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 49324073 - 49323990
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
49323990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 12740980 - 12741063
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
12741063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 22008817 - 22008734
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
22008734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 22016335 - 22016252
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
22016252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31480427 - 31480344
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
31480344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 474335 - 474252
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
474252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 32119511 - 32119428
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
32119428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 45002094 - 45002177
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45002094 |
ttttggtccctacaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
45002177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 54608591 - 54608674
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
54608674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 7957154 - 7957071
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtggcacatgatga |
7957071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 15979411 - 15979494
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgtacacgtgtcacatgatga |
15979494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 306 - 393
Target Start/End: Complemental strand, 25610062 - 25609975
Alignment:
| Q |
306 |
ttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
25610062 |
ttggttttggtccctgcaaatatgtctcgttttggttttggtccctgactccacttttctgatgatttgaacacgtggcacatgatga |
25609975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 26089803 - 26089886
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26089803 |
ttttggtccctgcaaatatgtctctttttggttttggtccctggctccacttttgtgataatttgtacacgtgtcacatgatga |
26089886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 28552310 - 28552227
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacatgtgtcacatgatga |
28552227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35565581 - 35565664
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtctctggctccacttttgtgatgatttgcacacgtggcacatgatga |
35565664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 51550155 - 51550238
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51550155 |
ttttggtccctgcaaatatgtctcattttggttttgatccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
51550238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 296 - 393
Target Start/End: Original strand, 53113442 - 53113539
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||| ||| ||| | |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgtttttggtcactgaccccacttttgtgatgatttgcacacatggcacatgatga |
53113539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 20644573 - 20644661
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20644573 |
tttgtttttgatccctgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgatttgcacatgtggcacatgatga |
20644661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 3387338 - 3387421
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacttggcacatgatga |
3387421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4034790 - 4034873
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
4034873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 8940452 - 8940369
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| || |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8940452 |
ttttgatccctgcaaatatgtctcattttggttttggtttctggctccacttttgtgataatttgcacacgtggcacatgatga |
8940369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 9262081 - 9261998
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
9261998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35177328 - 35177411
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| || |||||||||||||||||||||| ||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35177328 |
ttttggtccttgtaaatatgtctcgttttggttttggtctctggctccacttttgtgatgatttgcacacgtggcacatgatga |
35177411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 39132834 - 39132751
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||| | |||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgatttgcacacgtgacgcatgatga |
39132751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 45005959 - 45006042
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtgacacatgatga |
45006042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 47005227 - 47005310
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
47005227 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccatggccccacttttgtgatgatttgcacacgtggtacatgatga |
47005310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 47336301 - 47336384
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
47336301 |
ttttggtccctgcaaatatgtctcattttggttttggtcccttgctccacttttgtgataatttgtacacgtgtcacatgatga |
47336384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 52342509 - 52342426
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
52342426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 1721155 - 1721243
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||||| ||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1721155 |
tttgtttttgatccctgcaaatatgtctcgttttagttttggtccctggccccacttttgtgatgatttgcacatgtggcacatgatga |
1721243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 40277890 - 40277978
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| |||| ||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40277890 |
tttgtttttggtccctgaaaatatgtctcgttttgattttggtccctgaccccacttttgtgatgatttgcacacgtggcacatgatga |
40277978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 9603702 - 9603785
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
9603702 |
ttttggtccctgcaaatatgtcttattttggttttggtccctgactccacttttgtgatgatttgcacacgtgtcacatgatga |
9603785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 11463408 - 11463325
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||| ||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
11463408 |
ttttggtccctgcaaatatgcctcattttggttttggtccatggctccacttttttgatgatttgcacacgtggcacatgatga |
11463325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 19844339 - 19844422
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
19844339 |
ttttggtccctgtaaatatgcctcattttggttttggtccctggctgcacttttgtgatgatttgcacacgtgacacatgatga |
19844422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 43441343 - 43441426
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||| |||| | |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43441343 |
ttttggtccctgcaaatatgtctcattttagttttggtctctgggtccacttttgtgataatttgcacacgtgtcacatgatga |
43441426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 52956627 - 52956544
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttacacacgtgacacatgatga |
52956544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 12740905 - 12740962
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12740905 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 47336583 - 47336526
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47336583 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 51550448 - 51550391
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550448 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 54608865 - 54608808
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608865 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 474043 - 474099
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 12741272 - 12741216
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 4034717 - 4034772
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 26090078 - 26090023
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 28418614 - 28418697
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||| || |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28418614 |
tttttgtccctccaaatatgtctcattttggttttggttcctggccccacttttgtgatgatttgcacacgtggcacatgatga |
28418697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 29490670 - 29490587
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||| || ||||| |||||||||||||||||| | ||||||||||| |
|
|
| T |
29490670 |
ttttggtccttgcaaatatatctcgttttggttttggtccctagcgtcactcttgtgataatttgcacacatagcacatgatga |
29490587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 40370515 - 40370432
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| || || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccctttctccatttttgtgatgatttgcacacgtggcacatgatga |
40370432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 47114741 - 47114658
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||| | ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggttttgatctctgacctcacttttgtgatgatttgcacacgtgacacatgatga |
47114658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 290 - 352
Target Start/End: Original strand, 28552014 - 28552076
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28552014 |
atatctaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 348
Target Start/End: Complemental strand, 29490746 - 29490692
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29490746 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 474410 - 474353
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
474410 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 15979703 - 15979646
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 28552385 - 28552328
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28552385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 39436717 - 39436774
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
39436774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 51550080 - 51550137
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 14772285 - 14772369
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |||| | |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14772285 |
ttttggtccatgcaaatatgtctcgttttagttttagccccttaccccacttttgtgatgatttgtacacgtggcacatgatgat |
14772369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 22008525 - 22008581
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 22016043 - 22016099
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25615974 - 25616030
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 31480135 - 31480191
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 47005153 - 47005209
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 54608517 - 54608573
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 863579 - 863496
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| | ||||||| | || |||||||||| ||||||||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgaccccacttttattatgatttgcacacatggcacatgatga |
863496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 295 - 350
Target Start/End: Complemental strand, 9262157 - 9262102
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9262157 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 9597022 - 9596939
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||| ||||||| || |||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
9597022 |
ttttggtccctgcaaatacgcctcattttggttttggtccctgtctccacttttgagatgatttgcatacgtggcacatgatga |
9596939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 30034399 - 30034316
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||| |||| |||| || || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30034399 |
ttttggtccctgtaaatatgcctcattttgattttggtccttgtctccacttttgtgatgatttgcacacgtggcacatgatga |
30034316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 36673036 - 36673119
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||| | |||||||||||| |||| || |||||||||||||||| |
|
|
| T |
36673036 |
ttttggtccctgcaaataagtctcattttggttttggtccctgaccccacttttgtgatgatttacatacgtggcacatgatga |
36673119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 49323782 - 49323837
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 50008987 - 50009074
Alignment:
| Q |
305 |
tttggttttggtccctgcaaa-tatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||||| |||| || | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
50008987 |
tttgtttttggtccctgcaaaatacgtctcgttttggttttggtccatgaccccacttttgtgatgatttgcacacgtggcacatgat |
50009074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 3152113 - 3152055
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3152113 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
3152055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 327 - 393
Target Start/End: Complemental strand, 16679874 - 16679808
Alignment:
| Q |
327 |
atgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16679874 |
atgtctcgttttggttttagtccctgacctcatttttgtgatgatttgcacacgtggcacaagatga |
16679808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 22155927 - 22155985
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22155927 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgg |
22155985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 28427243 - 28427301
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28427243 |
taggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctgg |
28427301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 34238596 - 34238650
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 37506865 - 37506923
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37506865 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
37506923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 310 - 387
Target Start/End: Complemental strand, 8555235 - 8555158
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcaca |
387 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||||| | |||||||||||| ||||||||||||| |||| |
|
|
| T |
8555235 |
ttttgatccctgcaaatatgtcttgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtgtcaca |
8555158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 20612899 - 20612842
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
20612842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 28427609 - 28427552
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
28427552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 30034474 - 30034417
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30034474 |
taggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 30106222 - 30106165
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30106222 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 30128282 - 30128339
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30128282 |
taggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 30130156 - 30130213
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 31869958 - 31869901
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31869958 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
31869901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 32119218 - 32119275
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32119218 |
taggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 39288572 - 39288629
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgg |
39288629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 39437110 - 39437053
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
39437053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 297 - 350
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 40545562 - 40545619
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40545562 |
taggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 45002019 - 45002076
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45002019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 46622131 - 46622074
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 49324148 - 49324091
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49324148 |
taggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 51834607 - 51834664
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
51834664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 1721453 - 1721397
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 3151748 - 3151804
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3151748 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 4513262 - 4513318
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4513262 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4513621 - 4513565
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513621 |
aggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctg |
4513565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 4950036 - 4950092
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 9603627 - 9603683
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9603627 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 10976978 - 10977034
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
10977034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 19844582 - 19844526
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 289 - 349
Target Start/End: Complemental strand, 29446214 - 29446154
Alignment:
| Q |
289 |
tatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29446214 |
tatatataggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 29678319 - 29678231
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||| ||||||| |||||||||||||| ||| || || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
29678319 |
tttgtttttggtccctataaatatgcctcgttttggttttggtctctagccccacttttgtgatgatttgcacacgtggcacaagatga |
29678231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 32119585 - 32119529
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 35533345 - 35533433
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| ||| |||||||||||||||||||| |||| ||| || | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35533345 |
tttgtttttgatccttgcaaatatgtctcgttttgattttggtctctaaccccacttttgtgatgatttgcacacgtggcacatgatga |
35533433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 36732706 - 36732794
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||| | ||||||||| |||||||||| || |||| | |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36732706 |
tttgtttttggtccctgtagatatgtctcattttggttttggttcctgaccccacttttgtgatgatttgcacatgtggcacatgatga |
36732794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 37507223 - 37507167
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 40169654 - 40169598
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgg |
40169598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 43441604 - 43441548
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 45002386 - 45002330
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 47336227 - 47336283
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 48924241 - 48924185
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 290 - 349
Target Start/End: Complemental strand, 3830523 - 3830464
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3830523 |
atatttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 9261789 - 9261844
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 353
Target Start/End: Complemental strand, 22156292 - 22156237
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
22156237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 25710870 - 25710815
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
25710815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 35177254 - 35177305
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 54767244 - 54767327
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| || ||| | |||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
54767244 |
ttttggtccctgcaaatatgtctcgttttgtttttgatctctgaccccacttttgtgatgatttgctcacgtgacacatgatga |
54767327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 13514579 - 13514525
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13514579 |
taggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 350
Target Start/End: Original strand, 14772210 - 14772264
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 28452145 - 28452199
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 39288900 - 39288842
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39288900 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgg |
39288842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 47005521 - 47005467
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47005521 |
taggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 51834944 - 51834886
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgg |
51834886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 1721087 - 1721144
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| |||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
1721087 |
taggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 3387605 - 3387552
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 3830132 - 3830189
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3830132 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
3830189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 13584368 - 13584311
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgg |
13584311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 14633890 - 14633833
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| | ||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctgg |
14633833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 21159452 - 21159505
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 21159819 - 21159762
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21159819 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 25710508 - 25710565
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25710508 |
taggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 26799887 - 26799944
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
26799944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 382
Target Start/End: Original strand, 27681385 - 27681462
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtg |
382 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| |||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
27681385 |
tttgtttttggtccctgcaaatacgtctcgttttgattttggtccctgatcccacttttgtgatgatttgcacacgtg |
27681462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 28452378 - 28452321
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 28942906 - 28942849
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgg |
28942849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 29525104 - 29525157
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35407792 - 35407735
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
35407792 |
taggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 38232240 - 38232293
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 320 - 393
Target Start/End: Complemental strand, 38232525 - 38232452
Alignment:
| Q |
320 |
tgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||| ||||||||||| |||||| | ||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
38232525 |
tgcaaatatgtcttgttttggttttgatccctgacctcacttttgtgatgatttgtacacgtgacacatgatga |
38232452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 40169343 - 40169400
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctgg |
40169400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 5345690 - 5345634
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
5345634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 8510214 - 8510270
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctgg |
8510270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 9597096 - 9597040
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21553888 - 21553944
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg |
21553944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 29686543 - 29686599
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 30268504 - 30268560
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 30552479 - 30552423
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 35565507 - 35565563
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40277821 - 40277877
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 45320980 - 45320924
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
45320924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 51759818 - 51759874
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||| | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 2486829 - 2486746
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||| || |||| ||||| |||| | || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2486829 |
ttttgatccctgcaaatatgcttcattttagttttggtccatagccccacttttgtgatgatttgcacacgtggcacatgatga |
2486746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 4035053 - 4034998
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 4814899 - 4814845
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 7957226 - 7957171
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 9863404 - 9863349
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
9863349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 15016388 - 15016443
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 16123139 - 16123194
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 20405150 - 20405067
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| || |||||||||| ||| ||| || |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
20405150 |
ttttggtccttgcaaatatgcctaattttggttttggtctctgactccacttttgtgatgatttgcatacgtgacacatgatga |
20405067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 20644505 - 20644560
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 298 - 349
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 29445954 - 29446009
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29446009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 338 - 393
Target Start/End: Original strand, 29686639 - 29686694
Alignment:
| Q |
338 |
tggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| |||||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
29686639 |
tggttttggtccctggctccacttttgtgatgatttgaacacgtggcacatgatga |
29686694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 40370285 - 40370340
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 43440494 - 43440549
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 45313863 - 45313808
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 393
Target Start/End: Complemental strand, 53719246 - 53719171
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||| |||| || ||| | ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
53719246 |
cctgcaaatatgtctcgttttgattttgatcactgacctcacttttgtgatgatttgcacacgtgatacatgatga |
53719171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 7588315 - 7588369
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
7588315 |
ctaggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 307 - 353
Target Start/End: Complemental strand, 8510519 - 8510473
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8510519 |
tggttttagtccctgcaaatatgtttcgttttggttttagtccctgg |
8510473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 9603921 - 9603871
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
9603921 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 299 - 353
Target Start/End: Original strand, 14633547 - 14633601
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctgg |
14633601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 52342193 - 52342243
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
52342193 |
taggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 275442 - 275499
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
275442 |
taggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 863279 - 863332
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc |
863332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 10977342 - 10977285
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctgg |
10977285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 20611019 - 20611076
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgg |
20611076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 27681684 - 27681627
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
27681684 |
taggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 29955300 - 29955353
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
29955353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 29955668 - 29955611
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29955668 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 30004454 - 30004507
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30004507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 30004823 - 30004766
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30004823 |
taggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 36672961 - 36673014
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| ||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
36672961 |
taggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtc |
36673014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 39132908 - 39132851
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || | ||||||| |||||||| |
|
|
| T |
39132908 |
taggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctg |
39132851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 46751270 - 46751323
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 50196659 - 50196602
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
50196659 |
taggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 52342584 - 52342531
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 12673643 - 12673699
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 28942523 - 28942575
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
28942523 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 29678023 - 29678079
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 34582523 - 34582579
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34582523 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 318 - 382
Target Start/End: Complemental strand, 35937044 - 35936980
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtg |
382 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| | || |||||||||||| ||||||||||||| |
|
|
| T |
35937044 |
cctgcaaatatgtctcgttttagttttggtccatagccccacttttgtgatgatttgcacacgtg |
35936980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 40979711 - 40979655
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 45161116 - 45161164
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtc |
45161164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 46186772 - 46186720
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 46901102 - 46901154
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
46901102 |
taggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 54767524 - 54767472
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctg |
54767472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 298 - 353
Target Start/End: Complemental strand, 3361817 - 3361762
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctgg |
3361762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 19844265 - 19844320
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| || |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 30424628 - 30424679
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||| ||||| ||||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtc |
30424679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 299 - 346
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttag |
346 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 44802282 - 44802337
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 299 - 345
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 4321944 - 4322001
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||| || ||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
4321944 |
taggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctg |
4322001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 7518089 - 7518142
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| |||| || ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 294 - 351
Target Start/End: Original strand, 9863044 - 9863100
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||| |||||| ||||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
9863044 |
ctaggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 20405225 - 20405168
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
20405225 |
taggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 25609765 - 25609822
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||| | |||||| | |||||||||||||||||||||| |
|
|
| T |
25609765 |
taggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg |
25609822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 34238916 - 34238863
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
34238916 |
aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 348
Target Start/End: Complemental strand, 38232590 - 38232549
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
38232590 |
tggttttggtacctgcaaatatgtctcgttttggtttcagtc |
38232549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggt |
341 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| | ||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 49670803 - 49670746
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccc-tgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctgg |
49670746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 351
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 18175791 - 18175844
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctg |
18175844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 20644877 - 20644821
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||| | ||||||| |||||||||||| |
|
|
| T |
20644877 |
aggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 40545771 - 40545683
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||||||||| ||| ||| | || ||| ||||| | |||||||| || |||||||||| |
|
|
| T |
40545771 |
tttgtttttggtcactgcaaatatgcctcgttttggttttggtctctgaccccattttagtgatgaattgcacacatgacacatgatga |
40545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttag |
346 |
Q |
| |
|
|||||||| ||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 347
Target Start/End: Original strand, 36732651 - 36732690
Alignment:
| Q |
308 |
ggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36732651 |
ggttttggtccctgcaaatatgtcttattttggttttagt |
36732690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 39072213 - 39072158
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| ||||||||| ||||| |||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg |
39072158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 40279336 - 40279285
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
40279336 |
aggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 310 - 349
Target Start/End: Complemental strand, 43440774 - 43440735
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43440774 |
ttttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 298 - 349
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 50009284 - 50009229
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| | |||||||||||| |||||||||| ||||||||| ||||| |||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg |
50009229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 50261936 - 50261885
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| |||||| |||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 20907158 - 20907192
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctg |
20907192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 29678387 - 29678333
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| || |||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 299 - 345
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| |||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 350
Target Start/End: Original strand, 35936779 - 35936833
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 39132563 - 39132597
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39132563 |
cctgcaaatatgtttcgttttggttttagtccctg |
39132597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 39820665 - 39820607
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | |||| |||||| |||||||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccctgg |
39820607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 46724901 - 46724847
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||| || |||||||||||| | |||||| |||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctg |
46724847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 52403185 - 52403127
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| | |||| |||||| |||||||| |
|
|
| T |
52403185 |
taggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctgg |
52403127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 52956383 - 52956433
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| | ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
52956383 |
ggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 344 - 393
Target Start/End: Complemental strand, 4814795 - 4814746
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| | ||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4814795 |
tagtccctgacctcatttttgtgatgatttgcatacgtggcacatgatga |
4814746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 19297947 - 19297898
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| | |||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc |
19297898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 20907459 - 20907406
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
20907459 |
taggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtc |
20907406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 351
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 352
Target Start/End: Original strand, 29490379 - 29490424
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
29490379 |
tggttttggtccctacaaatatgcaccgttttggttttagtccctg |
29490424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 30130505 - 30130452
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||| |||| ||||||| ||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 350
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 351
Target Start/End: Original strand, 30552167 - 30552200
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
30552167 |
cctgcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 35498414 - 35498471
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||| ||| |||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
35498414 |
taggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 46724545 - 46724598
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || ||||| ||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctg |
46724598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 47114805 - 47114748
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | |||||||||| ||||||||| | ||||||| |||||||| |||| |
|
|
| T |
47114805 |
taggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctg |
47114748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Complemental strand, 47433870 - 47433837
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatat |
328 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
47433870 |
taggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 368
Target Start/End: Complemental strand, 48924167 - 48924110
Alignment:
| Q |
311 |
tttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgat |
368 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||||| ||||||| | |||||||||||| |
|
|
| T |
48924167 |
tttgatccttgcaaatatgtctcgtttgggttttggtccctgaccccacttttgtgat |
48924110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 51500396 - 51500449
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||| | ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
51500396 |
taggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 52401016 - 52401073
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| | |||| |||||| |||||||| |
|
|
| T |
52401016 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctgg |
52401073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 53121301 - 53121358
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
53121301 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctgg |
53121358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 11312569 - 11312513
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
11312569 |
aggctaaaatatggcattggtccatgcaaatatgttcagttttggttttagtccctg |
11312513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 16679963 - 16679907
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||| |||||||||||||||| |||||| ||||| ||||| |||||| |
|
|
| T |
16679963 |
aggctaaaagatggctttggtccctgcaaatttgtctcattttgattttaatccctg |
16679907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 20404888 - 20404940
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||| |||||| |||||||||| |
|
|
| T |
20404888 |
taggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 39072107 - 39072063
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
39072107 |
tagtccctgaccccacttttgtgataatttgcatacgtggcacat |
39072063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 293 - 329
Target Start/End: Original strand, 42446522 - 42446558
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatg |
329 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |
|
|
| T |
42446522 |
tctaggctaaaatatgcttttggtccctgcaaatatg |
42446558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 47901906 - 47901950
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||||||||||| |
|
|
| T |
47901906 |
tagtccctgactccacttttgtgatgatttgcatacgtggcacat |
47901950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 347
Target Start/End: Complemental strand, 52956690 - 52956650
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
52956690 |
tggttttggtctctgcaaatatgcatcgttttggttttagt |
52956650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 72; Significance: 1e-32; HSPs: 229)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 11976663 - 11976580
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
11976580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 3512193 - 3512110
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
3512110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4709979 - 4710062
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
4710062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 7326159 - 7326242
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
7326242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 9496650 - 9496567
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
9496567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 11019593 - 11019676
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
11019676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 34963373 - 34963456
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
34963456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 35097619 - 35097536
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
35097536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35346702 - 35346785
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35346702 |
ttttggtccctgcaaatatgtctcattttgattttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
35346785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 37536346 - 37536263
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
37536263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 296 - 393
Target Start/End: Complemental strand, 27117977 - 27117880
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||| |||||| |||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccctagcttcaattttgtgatgatttgcacacgtggcacgtgatga |
27117880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 2728524 - 2728441
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtgtcacatgatga |
2728441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 10337376 - 10337293
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10337376 |
ttttggtccctgcaaatatgtctcattttagttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
10337293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 28346685 - 28346602
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacatgtgtcacatgatga |
28346602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 32726198 - 32726115
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32726198 |
ttttggtccctgcaaatatgtctcattttggttttgatccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
32726115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 310 - 392
Target Start/End: Original strand, 10540522 - 10540604
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatg |
10540604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 25702811 - 25702713
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||| |||| || | |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttaattttgatctccggctccacttttgtgataatttgcacacgtggcacatgatga |
25702713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 1778637 - 1778720
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1778637 |
ttttggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
1778720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 7420303 - 7420386
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
7420386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 8298660 - 8298743
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
8298743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 20984219 - 20984302
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactcgacttttgtgataatttgcacacgtgtcacatgatga |
20984302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 23360444 - 23360528
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||| |||||||||||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
23360444 |
ttttggtccctgcaaatatgccttgttttggttttggtccttggcttcacttttgtgatgatttgcacatgtggcatatgatgat |
23360528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 23939615 - 23939703
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
23939615 |
tttgtttttggtccctgcaaatatatctcgttttggttttagtccctgaccccacttttgtgatgatttgcacatgtgacacatgatga |
23939703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4473777 - 4473860
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4473777 |
ttttagtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
4473860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 13232271 - 13232354
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtgacacatgatga |
13232354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 28497327 - 28497410
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28497327 |
ttttggtccctgcaaatatgaatcgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtggcacatgatga |
28497410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 42132937 - 42133020
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42132937 |
ttttggtctctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacctggcacatgatga |
42133020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 42430047 - 42429964
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctggccccatttttgtgatgatttgcacacgtggcacatgatga |
42429964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 44998191 - 44998109
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg-ctccacttttgtgatgatttgcacacgtggcacatgatga |
44998109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3512268 - 3512211
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3512268 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 10337117 - 10337174
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10337117 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 35097326 - 35097383
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097326 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35347000 - 35346943
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35347000 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 2355953 - 2356041
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| || |||| | ||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
2355953 |
tttgtttttggtccctgcaaatatgtttcgttttggttttggttcctgacctcacttttgtgatgatttgcacacatgacacatgatga |
2356041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 7420229 - 7420285
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 8298976 - 8298920
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 11019519 - 11019575
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 389
Target Start/End: Complemental strand, 13779467 - 13779383
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatg |
389 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||| || | |||||||||||| ||||||||| |||||||||| |
|
|
| T |
13779467 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccatgaccccacttttgtgatgatttgcacatgtggcacatg |
13779383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 394
Target Start/End: Complemental strand, 28324109 - 28324025
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||| ||| ||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
28324109 |
ttttggtccctacaaatatgtctcattttggttttggtcccttgctctacttttgtgatgatttacacacgtggcacatgatgat |
28324025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 32725906 - 32725962
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 7186004 - 7185949
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 8298587 - 8298642
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 318 - 393
Target Start/End: Complemental strand, 10873200 - 10873125
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
10873200 |
cctgcaaatatgcctcattttggttttggtccctggctccaattttgtgatgatttgcacacgtggcacatgatga |
10873125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 14489073 - 14489018
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 17074095 - 17074012
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||| || ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctgactccacttttatgatgatttgcacacgtgacacatgatga |
17074012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 17574175 - 17574258
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||| || ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctgactccacttttatgatgatttgcacacgtgacacatgatga |
17574258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 293 - 352
Target Start/End: Complemental strand, 32726275 - 32726216
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32726275 |
tctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 42133154 - 42133099
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 294 - 352
Target Start/End: Original strand, 9496338 - 9496396
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9496338 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 20277760 - 20277846
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
20277760 |
tttgtttttagtccctgcaaatatgcttcgttttggttttggtccctggccccacttttgtgatgatttgaacacgtggcacatgat |
20277846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 21064387 - 21064473
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
21064387 |
tttgtttttagtccctgcaaatatgcttcgttttggttttggtccctggccccacttttgtgatgatttgaacacgtggcacatgat |
21064473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 35115641 - 35115543
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||| |||||||||||||| ||||||| | |||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
35115641 |
taggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctgaccccacttttgtgatgatttgcatacgtgacacatgatga |
35115543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 4473702 - 4473759
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4473702 |
taggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 4710222 - 4710165
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4710222 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 11019859 - 11019802
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11019859 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 11976738 - 11976681
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11976738 |
taggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 17073805 - 17073862
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17073805 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 17574465 - 17574408
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17574465 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 25600228 - 25600285
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25600228 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 28346760 - 28346703
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28346760 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 29158352 - 29158409
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2728231 - 2728287
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 11976372 - 11976428
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 14238750 - 14238806
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14238806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 20984145 - 20984201
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 20984511 - 20984455
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 28346393 - 28346449
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 34963299 - 34963355
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 37536085 - 37536141
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 7326421 - 7326366
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 9175298 - 9175216
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || || | | |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
9175298 |
ttttggtccctgcaaatatgtctcgttttggttttggt-ccagaccccacttttgtgatgatttgcacacatggcacatgatga |
9175216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 13154959 - 13155042
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| ||||||| | ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
13154959 |
ttttggtccctgcaaatatgtttcgttttgattttggtccctgaccccacttttgtattgatttgcacacgtggcacatgatga |
13155042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 14847898 - 14847981
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||||| || |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
14847898 |
ttttgatccctgcaaatatgtctcgttttgattttggtccctagccccacttttgtgatgatttgcacatgtgacacatgatga |
14847981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 24090192 - 24090275
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||| || |||||||||||| || |||||| ||| |||||||||| |
|
|
| T |
24090192 |
ttttggttcctgcaaatatgtctcgttttggttttcgtccctagccccacttttgtgatgatatgcacatgtgacacatgatga |
24090275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 25600304 - 25600387
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||| || |||||||||||| |||||||||| || |||||||||| |
|
|
| T |
25600304 |
ttttggtccctgcaaatatgccttattttggttttggtccctgtctccacttttgtgatgatttgcacacatgacacatgatga |
25600387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 352
Target Start/End: Original strand, 40492956 - 40493015
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40492956 |
tctaggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 1526174 - 1526116
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1526174 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgg |
1526116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 8094477 - 8094535
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8094477 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctgg |
8094535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 19494117 - 19494175
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgg |
19494175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 3511904 - 3511961
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3511904 |
taggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 7326084 - 7326141
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7326084 |
taggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 10337451 - 10337394
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
10337451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 16644045 - 16643988
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16644045 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgg |
16643988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 19494414 - 19494357
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
19494357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 22917563 - 22917620
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
22917620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 27117751 - 27117808
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27117751 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 316 - 393
Target Start/End: Complemental strand, 36044712 - 36044635
Alignment:
| Q |
316 |
tccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| | ||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
36044712 |
tccctgcaaatatatctcgttttggttttggtccctgacctcacttttgtgatgatttgcacatgtgatacatgatga |
36044635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4474045 - 4473989
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 5357421 - 5357477
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5357421 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 7272419 - 7272471
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 7420591 - 7420535
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 9175011 - 9175067
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 9496724 - 9496668
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 287 - 351
Target Start/End: Original strand, 10540439 - 10540503
Alignment:
| Q |
287 |
tttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||| ||||||||||| | ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10540439 |
tttatatttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 10540783 - 10540727
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 10872914 - 10872970
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 14239081 - 14239025
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 16789074 - 16789130
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 20277691 - 20277747
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21064318 - 21064374
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 22650463 - 22650519
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24187898 - 24187842
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24815069 - 24815013
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 24955012 - 24954956
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24955012 |
taggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25131110 - 25131166
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 25600598 - 25600542
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 27341592 - 27341536
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 28324182 - 28324126
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 43477162 - 43477218
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 4621281 - 4621198
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| |||||||||||| ||| ||||| |||| |||||| ||| |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4621281 |
ttttggttcctgcaaatatgcctcattttgattttggtcccttgctccacttttgtgatgatttgcacacgtcacacatgatga |
4621198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 4621354 - 4621299
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 16789369 - 16789314
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16789314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 354
Target Start/End: Original strand, 1525808 - 1525866
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggc |
354 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggc |
1525866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 16643659 - 16643717
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16643659 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgg |
16643717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 20278059 - 20278005
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20278059 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 21064686 - 21064632
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21064686 |
taggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 293 - 350
Target Start/End: Complemental strand, 8094845 - 8094788
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
8094845 |
tctaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 13155253 - 13155196
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||| |||||| |
|
|
| T |
13155253 |
taggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg |
13779204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 297 - 350
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 32418317 - 32418370
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 33526414 - 33526357
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 38930301 - 38930358
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctgg |
38930358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4017301 - 4017245
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 382
Target Start/End: Complemental strand, 5357690 - 5357618
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtg |
382 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||| ||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
5357690 |
ttttggtccctgcaaatatgcttcattttagttttggtccctgactccacttttgtgatgatttgcacacgtg |
5357618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 14495068 - 14495124
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 24814780 - 24814861
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||| | ||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24814780 |
ttttggtccctgcaaat--gtctcattttggttttggtccctgaccccacttttgttatgatttgcacacgtagcacatgatga |
24814861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 29488111 - 29488055
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
29488055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 29992226 - 29992145
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||| | |||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
29992226 |
ttttggtccctgcaaat--gtctcattttggttttggtccctgaccccacttttgtgatgatttacacacgtgacacatgatga |
29992145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 309 - 393
Target Start/End: Complemental strand, 33652483 - 33652399
Alignment:
| Q |
309 |
gttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| || ||| ||||||||||||||||| |||| ||| | | ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33652483 |
gttttgatctctgtaaatatgtctcgttttgattttggtcattaacctcacttttgtgatgatttgcacacgtggcacatgatga |
33652399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 309 - 352
Target Start/End: Complemental strand, 1778917 - 1778874
Alignment:
| Q |
309 |
gttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctg |
1778874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 4375692 - 4375747
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
4375747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 7272751 - 7272696
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 10776499 - 10776444
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 295 - 350
Target Start/End: Original strand, 33636320 - 33636375
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 298 - 345
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 40066820 - 40066765
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 40844156 - 40844211
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 352
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 6146948 - 6146894
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
6146894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 299 - 345
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| || ||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 6469278 - 6469335
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6469278 |
taggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 6469669 - 6469612
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
6469669 |
taggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctg |
6469612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 9175373 - 9175320
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| ||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9175373 |
taggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13154884 - 13154941
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | |||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
13154884 |
taggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 18549199 - 18549252
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 19962993 - 19963050
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||| || |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
19962993 |
taggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 25702510 - 25702567
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25702510 |
taggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 28399037 - 28398980
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28399037 |
taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg |
28398980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 28497254 - 28497307
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 29992302 - 29992245
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29992302 |
taggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 32040073 - 32040130
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || | || |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32040073 |
taggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35345619 - 35345562
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| ||||||||||||||| |||||| |
|
|
| T |
35345619 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 38930665 - 38930608
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctgg |
38930608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 1162909 - 1162965
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctgg |
1162965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 3680802 - 3680746
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 6469598 - 6469510
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| ||| ||||||||| |||| |||||||||| ||||||| | |||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
6469598 |
tttgtttttgatccatgcaaatatatctcattttggttttggtccctgaccccacttttgtgattatttaaacacgtggcacattatga |
6469510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 13796305 - 13796392
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |||| | || ||||||| |||| |||| |||||||| ||||||||| |
|
|
| T |
13796305 |
tttggttttggtccctgcaaatatgtat-gttttggttttggtccatagccccacttttctgatgatttacacacgtgatacatgatga |
13796392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 13796593 - 13796541
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||| | |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctg |
13796541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21125718 - 21125774
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 24187568 - 24187624
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg |
24187624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 29158669 - 29158617
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| || |||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40066496 - 40066552
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| |||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 1408354 - 1408299
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 298 - 349
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 14496815 - 14496870
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 302 - 349
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 28323848 - 28323903
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28323848 |
aggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 294 - 349
Target Start/End: Complemental strand, 43727436 - 43727382
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||| ||||||| ||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43727436 |
ctagcctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 28258243 - 28258189
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
28258243 |
taggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttag |
346 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 350
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||| |||| || ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 21126023 - 21125966
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | ||||| |||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
21126023 |
taggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35143846 - 35143789
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
35143846 |
taggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 297 - 342
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtt |
342 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 44997930 - 44997979
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 352
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
| Q |
320 |
tgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 9832214 - 9832270
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||| | |||||||||||| |||||| |
|
|
| T |
9832214 |
aggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctg |
9832270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 14488715 - 14488767
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| | ||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 318 - 350
Target Start/End: Complemental strand, 14848169 - 14848137
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14848169 |
cctgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 318 - 394
Target Start/End: Original strand, 16010674 - 16010750
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| ||| | ||||||||||| ||||| ||||||| | ||||||||| |
|
|
| T |
16010674 |
cctgcaaatatgtctcgttttgattttggtctctgacccaacttttgtgatgatttgtacacgtgactcatgatgat |
16010750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 291 - 351
Target Start/End: Original strand, 24090113 - 24090173
Alignment:
| Q |
291 |
tatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||| |||||||||| |||||||||| | || | ||||||||||||||| ||||||||||| |
|
|
| T |
24090113 |
tatcaaggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 29991918 - 29991966
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 42429757 - 42429812
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 2811514 - 2811597
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||| ||| || | |||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
2811514 |
ttttgatccctgcaaatatacctcattttggttttgatccatgaccccacttttgtgatgatttgtatacgtggcacatgatga |
2811597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 305 - 352
Target Start/End: Original strand, 13796275 - 13796321
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
13796275 |
tttgtttttggtccctgcaaatatgtct-gttttggttttggtccctg |
13796321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| || ||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 301 - 348
Target Start/End: Complemental strand, 17074164 - 17074117
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
17074164 |
aaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17074117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 32195280 - 32195331
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtc |
32195331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 23360381 - 23360423
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23360381 |
tggttttggtctctgcaaatatgtctcgttttaattttagtcc |
23360423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 2356250 - 2356197
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| || ||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
2356250 |
taggttaaaatatgattttgattcatgcaaatatgtctcgttttggttttagtc |
2356197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 4376012 - 4375960
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376012 |
taggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 23939907 - 23939858
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| |||||||| | |||||||||||| |||||||||| |||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtcc |
23939858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 3031602 - 3031546
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||| ||| |||||| |||||||| |
|
|
| T |
3031602 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctgg |
3031546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 393
Target Start/End: Complemental strand, 15931149 - 15931113
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
15931149 |
cacttttgtgatgatttgcacacgtgtcacatgatga |
15931113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 22650573 - 22650617
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
22650573 |
tagtccctggccccacttttgtgatgatttgcatacgtggcacat |
22650617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 329
Target Start/End: Complemental strand, 30969717 - 30969685
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatg |
329 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 31445464 - 31445412
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| | |||||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 36044434 - 36044490
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
36044434 |
taggctaaaatatggtttaggtccctacaaatatttctcgtttcaattttagtccct |
36044490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 1e-32; HSPs: 181)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 3968718 - 3968801
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
3968801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 6412506 - 6412423
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
6412423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 21994330 - 21994247
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21994330 |
ttttggtccctgcaaatatgtctctttttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
21994247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 22543645 - 22543562
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
22543562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 1214762 - 1214850
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1214762 |
tttgtttttggtccctgcaaatatgtcttgttttggttttagtccctggctctacttttgtgatgatttgcacacgtgacacatgatga |
1214850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 12298891 - 12298975
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12298891 |
ttttggtccatgcaaatatgtctcgttttggttttggtccctggccccacttttgtgatgatttgcacacgtggcacatgatgat |
12298975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 31198688 - 31198771
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
31198771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 310 - 392
Target Start/End: Original strand, 25137066 - 25137148
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatg |
25137148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 19320840 - 19320923
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19320840 |
ttttggtccttgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
19320923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 21385324 - 21385407
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| | ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgggtccacttttgtgataatttgcacacatgtcacatgatga |
21385407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 296 - 393
Target Start/End: Original strand, 23502236 - 23502333
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| ||| | | | ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtctccgacctcaattttgtgatgatttgcacatgtggcacatgatga |
23502333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 25121429 - 25121341
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| |||| ||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
25121429 |
tttgtttttggtccctgcaaatatgtctcattttgattttggtccctggccccacttttgtgatgatttgcacacgtgacacatgatga |
25121341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 391
Target Start/End: Original strand, 31276112 - 31276196
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||| ||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
31276112 |
tggttttggtccctacaaatatgcctcattttggttttggtccctgacttcatttttgtgatgatttgcacacgtggcacatgat |
31276196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 3414679 - 3414596
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3414679 |
ttttggtccctgcaaatatgtctcatttgtgttttggtccctggctccacttttgtgattatttgcacatgtggcacatgatga |
3414596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 20467424 - 20467507
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||| | ||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20467424 |
ttttgatcccggtaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
20467507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 30479132 - 30479215
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||||| ||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
30479132 |
ttttggtccctgcaaatatatctcgttttagttttggtccctggccccacttttgtgataatttgcgcacgtgacacatgatga |
30479215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 310 - 392
Target Start/End: Complemental strand, 27765101 - 27765019
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |||||||||| || ||||||||| |
|
|
| T |
27765101 |
ttttggtccctgcaaatatgtctcgttttggttttggtctctggccccacttttgtgatgatttgcacacatgacacatgatg |
27765019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 291 - 352
Target Start/End: Original strand, 3414381 - 3414442
Alignment:
| Q |
291 |
tatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3414381 |
tatctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 6412216 - 6412273
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412216 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 10910966 - 10910909
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10910966 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 383
Target Start/End: Original strand, 13268182 - 13268255
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtgg |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtgg |
13268255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 391
Target Start/End: Original strand, 13617602 - 13617683
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||| || ||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617602 |
ttttggtccctgcaaatatgcctcattttggttttggtctctagctccacttttgtgatgatttgcacacgtggcacatgat |
13617683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 22543720 - 22543663
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22543720 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 310 - 391
Target Start/End: Original strand, 24901311 - 24901392
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| || |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtgacacatgat |
24901392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 3968644 - 3968700
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 19690392 - 19690448
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21385250 - 21385306
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 293 - 348
Target Start/End: Complemental strand, 8170155 - 8170100
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8170155 |
tctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 10910891 - 10910808
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||| ||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
10910891 |
ttttggtccctgcaaatatgcatcattttggttttggtccttggctccacttttgtgatgatttacacacgtggcacatgatga |
10910808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 310 - 379
Target Start/End: Original strand, 1007197 - 1007266
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacac |
379 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacac |
1007266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 1007511 - 1007454
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1007511 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 3276355 - 3276302
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3969011 - 3968954
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3969011 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 18024377 - 18024320
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18024377 |
taggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 21993785 - 21993842
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21993785 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 21994405 - 21994348
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21994405 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 22543352 - 22543409
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543352 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 25137359 - 25137302
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25137359 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 25431856 - 25431799
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 3414753 - 3414697
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 12757609 - 12757661
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 14656261 - 14656205
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 30928680 - 30928736
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 8170079 - 8169997
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||||| ||| |||||||| ||||||||||||| |||||||||| |
|
|
| T |
8170079 |
ttttggtccctacaaatatgtctcattttggttttggtccctggccccac-tttgtgatgatttgcacacgtgacacatgatga |
8169997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 19275223 - 19275140
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||| |||| |||||||||| ||| ||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtctctggtcccatttttatgatgatttgcacacatggtacatgatga |
19275140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 298 - 393
Target Start/End: Complemental strand, 23629101 - 23629006
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| |||||||||| ||| |||||||||||| |||| ||||| ||| |||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
23629101 |
gctaaaatatggttttggttcctacaaatatgtctcattttagttttggtctctggtcccacttttgtgatgatttgtacacgtggcacatgatga |
23629006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 392
Target Start/End: Complemental strand, 3276281 - 3276199
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||||||| || |||||||| ||| |||||||||| ||| |||||| |||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
3276281 |
ttttggtctctacaaatatgcctcattttggttttggtctctggctccacttttgtgatgatttgcacacgtgacacatgatg |
3276199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 7156162 - 7156104
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
7156104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 286 - 352
Target Start/End: Original strand, 21147393 - 21147459
Alignment:
| Q |
286 |
ttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21147393 |
ttttaaatataggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 24692982 - 24692924
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24692982 |
ctaggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 1007122 - 1007179
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1007122 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 6564945 - 6564893
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564945 |
taggctaaaatt-ggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 12176645 - 12176588
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12176645 |
taggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 15076205 - 15076148
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
15076148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 19129522 - 19129465
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19129522 |
taggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 20467720 - 20467663
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20467720 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 24274132 - 24274075
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
24274075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 25121498 - 25121441
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25121498 |
taggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 33801744 - 33801687
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
33801687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 1214998 - 1214942
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1214998 |
taggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 6412580 - 6412524
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 12299141 - 12299085
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 363
Target Start/End: Original strand, 19129334 - 19129402
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcactttt |
363 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
19129334 |
taggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctggccccactttt |
19129402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 19321133 - 19321081
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19321133 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 21385585 - 21385529
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 23502541 - 23502485
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25136993 - 25137049
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 10910629 - 10910684
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 300 - 351
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 13268108 - 13268163
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 15962389 - 15962334
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 17765302 - 17765219
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| ||| ||||||||||| ||||| ||||||| || ||||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccctagctcaacttttgtgatgatttgtacacgtgacagatgatga |
17765219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 314 - 392
Target Start/End: Original strand, 19690471 - 19690550
Alignment:
| Q |
314 |
ggtccctgcaaatatgtctcgttttggttttagtccc-tggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||| | |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19690471 |
ggtccttgcaaatatgtctcgttttggttttggtctcatggcccaacttttgtgatgatttgcacacgtggcacatgatg |
19690550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 353
Target Start/End: Original strand, 31166871 - 31166926
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
31166926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 290 - 353
Target Start/End: Original strand, 32885666 - 32885729
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||| ||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32885666 |
atatataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgg |
32885729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 34582529 - 34582584
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
34582584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 1890454 - 1890396
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1890454 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
1890396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 293 - 351
Target Start/End: Original strand, 2615868 - 2615926
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2615868 |
tctaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 8680773 - 8680831
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8680773 |
taggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
8680831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 350
Target Start/End: Original strand, 11448536 - 11448590
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 12419940 - 12419882
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12419940 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgg |
12419882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 14655377 - 14655435
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgg |
14655435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 317810 - 317867
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
317810 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg |
317867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 318099 - 318042
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
318099 |
taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 351
Target Start/End: Original strand, 6564595 - 6564636
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 7155796 - 7155853
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
7155853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 8681117 - 8681060
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgg |
8681060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 9896638 - 9896585
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 15722608 - 15722665
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 15962025 - 15962082
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 22822652 - 22822595
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
22822595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 34582894 - 34582837
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34582894 |
taggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 494405 - 494457
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 301 - 353
Target Start/End: Original strand, 543365 - 543417
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
543417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 10091039 - 10091091
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
10091091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 11925961 - 11925893
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| | || |||||||||||| ||||||||| |
|
|
| T |
11925961 |
ttttggtcccttcaaatatgtctcgttttggttttggtccatagccccacttttgtgatgatttgcaca |
11925893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 289 - 349
Target Start/End: Original strand, 12419700 - 12419760
Alignment:
| Q |
289 |
tatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
12419700 |
tatatataggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 17765376 - 17765320
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| | ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21995063 - 21995119
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 26375692 - 26375748
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctg |
26375748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 31167200 - 31167144
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctgg |
31167144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 298 - 345
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 1214695 - 1214750
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 300 - 351
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 12757864 - 12757781
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| ||||||||| |||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
12757864 |
ttttggtccttgcaaatatgcatcgttttggttttggtccctggccccacttttgtgatgggttgcacatgtgacacatgatga |
12757781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 309 - 352
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
| Q |
309 |
gttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 14655903 - 14655958
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg |
14655958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 305 - 352
Target Start/End: Complemental strand, 19129452 - 19129405
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19129452 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 19267565 - 19267620
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 19296407 - 19296352
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 30929044 - 30928989
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30928989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 309 - 352
Target Start/End: Complemental strand, 31276328 - 31276285
Alignment:
| Q |
309 |
gttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31276328 |
gttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 299 - 353
Target Start/End: Complemental strand, 5286949 - 5286895
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgg |
5286895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 14428651 - 14428705
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
14428705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 350
Target Start/End: Complemental strand, 22792900 - 22792846
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 348
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 351
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| || |||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 3356141 - 3356194
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 7324194 - 7324137
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7324194 |
taggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 12612361 - 12612304
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||| || ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
12612361 |
taggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg |
12612304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 310 - 391
Target Start/End: Original strand, 14655976 - 14656057
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||| ||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
14655976 |
ttttggtctttgcaaatatgcatcgttttggttttggtccctggccccacttttgtgacgatttgcacatgtgacacatgat |
14656057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 305 - 366
Target Start/End: Complemental strand, 19267846 - 19267785
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtg |
366 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| ||||||| | |||||||||| |
|
|
| T |
19267846 |
tttgtttttggtccctgcaaatatgtctcattttggttttggtccctgaccccacttttgtg |
19267785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 31398542 - 31398489
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 33808619 - 33808676
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctgg |
33808676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2373178 - 2373234
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 6468309 - 6468365
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 6564877 - 6564789
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||||||||| |||| || | ||||||| | || |||||||||| ||| ||||||||| |
|
|
| T |
6564877 |
tttgtttttggtccatgcaaatatgcctcgttttggttttggtccttgaccccactttttttatgatttgcacacatggaacatgatga |
6564789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 11449170 - 11449114
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 11926035 - 11925983
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
11926035 |
taggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 13150751 - 13150695
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 19267913 - 19267857
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||||| | |||||||||||||||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctg |
19267857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 301 - 349
Target Start/End: Complemental strand, 19690755 - 19690708
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 24273827 - 24273883
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 33131851 - 33131795
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 11925739 - 11925790
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtc |
11925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 21995425 - 21995370
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 342
Target Start/End: Original strand, 30479061 - 30479108
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtt |
342 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
30479061 |
taggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 31186591 - 31186536
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 15722678 - 15722764
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| ||||||||| || ||||||| ||||||||| |||| ||||| | | ||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
15722678 |
tttgtttttggtccttgtaaatatgcctcgttttgattttggtccccgaccccacttttatgatcatttgcacacgtgacacatgat |
15722764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 777676 - 777733
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctgg |
777733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 353
Target Start/End: Original strand, 1890062 - 1890115
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctgg |
1890115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg |
9896333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 24901556 - 24901499
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctg |
24901499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 25121182 - 25121234
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
25121182 |
taggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 344
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 352
Target Start/End: Original strand, 7323891 - 7323923
Alignment:
| Q |
320 |
tgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7323891 |
tgcaaatatgtctcgttttggttttagtccctg |
7323923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 19296107 - 19296163
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 393
Target Start/End: Complemental strand, 21994072 - 21994036
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21994072 |
cacttttgtgataatttgcacacgtgtcacatgatga |
21994036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 393
Target Start/End: Original strand, 31185754 - 31185790
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31185754 |
cacttttgtgatgatttgcacacgtggcacatgatga |
31185790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 312 - 392
Target Start/End: Complemental strand, 31186515 - 31186435
Alignment:
| Q |
312 |
ttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
||||||| |||||||||| || |||| ||||| ||| || || |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
31186515 |
ttggtccatgcaaatatgcttcattttagttttggtctcttactccacttttgtgatgatttgcacacgtggcacacgatg |
31186435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 23770441 - 23770398
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||| |
|
|
| T |
23770441 |
taggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 298 - 349
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 543726 - 543668
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| | |||||||||||| ||||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctgg |
543668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 299 - 349
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||| ||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 8169785 - 8169842
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||| | |||||| ||||| |||||| |
|
|
| T |
8169785 |
taggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctg |
8169842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 344 - 393
Target Start/End: Complemental strand, 12612252 - 12612203
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||| || ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
12612252 |
tagtctctggctccatttttgtgatgatttgcatacgtggcacatgatga |
12612203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 338
Target Start/End: Complemental strand, 13268460 - 13268419
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
13268460 |
ggctaaaataaggttttggtccctgcaaatatgtctggtttt |
13268419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 15116671 - 15116721
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
15116671 |
taggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 342
Target Start/End: Original strand, 27764909 - 27764958
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggtt |
342 |
Q |
| |
|
|||| |||||||| ||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
27764909 |
tctatgctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 1890166 - 1890210
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
1890166 |
tagtccctgacctcacttttgtgataatttgcatacgtgacacat |
1890210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 12176385 - 12176437
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| | || || |||||||||||||||| |||||||||| |
|
|
| T |
12176385 |
ggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtcc |
12176437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 12757936 - 12757888
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| || ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggtttta |
12757888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 24692875 - 24692831
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
24692875 |
tagtccctgacctcacttttgtgatgatttgcatacgtggcacat |
24692831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 336
Target Start/End: Complemental strand, 27765173 - 27765137
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgtt |
336 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgtt |
27765137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 204)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 24443453 - 24443536
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
24443536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 1381538 - 1381455
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
1381455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 20985798 - 20985881
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20985798 |
ttttggtccctgcaaatatgtctcattttggttttgatccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
20985881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35928137 - 35928220
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
35928220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 37271633 - 37271550
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtggcacatgatga |
37271550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 6912571 - 6912654
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacatgtgtcacatgatga |
6912654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 19565758 - 19565675
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctctacttttgtgataatttgcacacgtgtcacatgatga |
19565675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 318 - 393
Target Start/End: Original strand, 19685097 - 19685172
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19685097 |
cctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
19685172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35876761 - 35876844
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgtacacgtgtcacatgatga |
35876844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 40764488 - 40764571
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacatgtgtcacatgatga |
40764571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 394
Target Start/End: Complemental strand, 1105075 - 1104991
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccaattttgtgatgatttgcacacgtggcacatgatgat |
1104991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5917387 - 5917303
Alignment:
| Q |
310 |
ttttggtccctgcaaa-tatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5917387 |
ttttggtccctgcaaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
5917303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 2636742 - 2636825
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2636742 |
ttttggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
2636825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 310 - 391
Target Start/End: Original strand, 31602221 - 31602301
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtcgct-gccccacttttgtgatgatttgcacacgtggcacatgat |
31602301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 28871711 - 28871792
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | || |||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctggctccacttttgtgatga--tgtacacgtggcacatgatga |
28871792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 40038563 - 40038651
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||| |||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40038563 |
tttgtttttggtccctgcaaatatgcctcattttcattttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
40038651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 45430 - 45347
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||| ||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
45430 |
ttttggtccctgcaaatatgtctcattttggttttggtctctgacttcatttttgtgatgatttgcacacgtggtacatgatga |
45347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 28213446 - 28213529
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctggccccacttttgtgatgatttgcacacgtgacacatgatga |
28213529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 32108880 - 32108963
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| | || ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32108880 |
ttttggtccctgcaaatatgcctcattttggttttggcccgtggctccacttttgtgatgatttgcacacgtggcacatgatga |
32108963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 5917124 - 5917181
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917124 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 19685015 - 19685072
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19685015 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 1381246 - 1381302
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 19565466 - 19565522
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 20661021 - 20661105
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| ||||||| | |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
20661021 |
ttttggtccttgcagatatgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtgacacatgatgat |
20661105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 288 - 352
Target Start/End: Complemental strand, 24443753 - 24443689
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24443753 |
ttatatataggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 45138 - 45193
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 4736469 - 4736386
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||| ||||||| || |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
4736469 |
ttttggtctctgcaaatatgcctcattttggtttttgtccctgactccacttttgtgatgatctgcacacgtggcacatgatga |
4736386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 17070608 - 17070691
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| | ||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17070608 |
ttttggtccctgtaaatatggctcgttttggttttggcccctgaccccacttttgtgatgatttgcacacgtggcacatgatga |
17070691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 18258236 - 18258319
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18258236 |
ttttggcccctgcaaatatgtctcattttggttttgatccctgactcgacttttgtgataatttgcacacgtgtcacatgatga |
18258319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 30888160 - 30888215
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 35928458 - 35928403
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 36973426 - 36973509
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| |||||| ||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
36973426 |
ttttggtccctgcaaatatgcctcattttgattttggtccctagctccacttttgtgatgatttgcacacgtgacacatgatga |
36973509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 1105150 - 1105093
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1105150 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 18258528 - 18258475
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 19565833 - 19565776
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19565833 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 20690731 - 20690784
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35877054 - 35876997
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35877054 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
35876997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 36577720 - 36577777
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36577777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 1381612 - 1381556
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4736543 - 4736487
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 5917461 - 5917405
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 19685381 - 19685325
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 20690800 - 20690887
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| ||||||| | |||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
20690800 |
tttgtttttggtccctgcaaatatgtctcgttttagtttt-gtccctgaccccacttttgtgatgatttgcatacatggcacatgatga |
20690887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 26133414 - 26133358
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 35928063 - 35928119
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 37271707 - 37271651
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 38170513 - 38170569
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40764414 - 40764470
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 299 - 378
Target Start/End: Complemental strand, 12145181 - 12145102
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| ||| ||||| ||||||| |||| ||||||||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttggtctctggccccacttttttgatgatttgcaca |
12145102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 352
Target Start/End: Complemental strand, 30800854 - 30800795
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30800854 |
tctaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 310 - 388
Target Start/End: Original strand, 15916359 - 15916437
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||||| | ||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
15916359 |
ttttggtccttacaaatatgtctcgttttggttttggtccctgacctcacttttgtgatgatttgcacatgtgacacat |
15916437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 29875727 - 29875669
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29875727 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
29875669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 1104856 - 1104913
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1104856 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3850601 - 3850544
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 4203772 - 4203715
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4203772 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 5950174 - 5950231
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5950174 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
5950231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 10744056 - 10743999
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
10743999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 18633598 - 18633655
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
18633655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 20660947 - 20661000
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 24781987 - 24782044
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24781987 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 29172887 - 29172830
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
29172830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 29692742 - 29692799
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29692742 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 30800492 - 30800549
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30800492 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 37271357 - 37271414
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
37271357 |
taggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 38496783 - 38496726
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgg |
38496726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2217493 - 2217549
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 7075571 - 7075627
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 10830597 - 10830685
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||||||||| ||||||| | |||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
10830597 |
tttgtttttggttgctgcaaatatggctcgttttggttttggtccctgaccccacttttgtgatgatttgcacacgtgacacaagatga |
10830685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 18046037 - 18046093
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 18258161 - 18258217
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 20986090 - 20986034
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 21124912 - 21124968
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 24443379 - 24443435
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 317 - 393
Target Start/End: Original strand, 26071370 - 26071446
Alignment:
| Q |
317 |
ccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||| ||||||||| |||||||| ||| | |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26071370 |
ccctgcaaatatgcctcgttttgattttagtctctgaccccacttttgtgatgatttgcacacgtagcacatgatga |
26071446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 28863509 - 28863565
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 35167166 - 35167110
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 35876687 - 35876743
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 36578084 - 36578028
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 40764781 - 40764725
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 349
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 9588539 - 9588456
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||| || ||| || ||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9588539 |
ttttggtctctgcaaatatgcctcattttggttttgatcgctgactccacttttgtgataatttacatacgtggcacatgatga |
9588456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 28550827 - 28550882
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28550882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 28863838 - 28863783
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 353
Target Start/End: Original strand, 29172524 - 29172579
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
29172579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 29366949 - 29366894
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 33336026 - 33335971
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
33335971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 40029497 - 40029442
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 293 - 352
Target Start/End: Original strand, 42207238 - 42207297
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
42207238 |
tctaggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctg |
42207297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 348
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 14318043 - 14318097
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 351
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 18046350 - 18046296
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18046350 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 31037743 - 31037693
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31037743 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 35166160 - 35166102
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||| ||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35166160 |
taggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctgg |
35166102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 5614165 - 5614218
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 5614532 - 5614475
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5614532 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 10408927 - 10408984
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
10408984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 10743723 - 10743776
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 310 - 391
Target Start/End: Complemental strand, 11935897 - 11935816
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| ||||||| | | ||||| |||| |||||||||||||| ||||||| |
|
|
| T |
11935897 |
ttttggtccctgcaaatacgtctcgttttgatttttgtccctgaccccccttttatgatgatttgcacacgtggtacatgat |
11935816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 15635708 - 15635651
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctgg |
15635651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 16038376 - 16038429
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 23381948 - 23382005
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 28213372 - 28213425
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 32108806 - 32108863
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
32108806 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 40168010 - 40167953
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40168010 |
taggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 1286979 - 1286891
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||| ||||||| | |||||||||||| ||||||| |||| ||||| |||| |
|
|
| T |
1286979 |
tttgtttttggtccctgcaaatatgcctcattttggttttggtccctgtccccacttttgtgatgatttgcaagcgtgacacataatga |
1286891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||| | ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 6118499 - 6118443
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgg |
6118443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 11799459 - 11799403
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 17070534 - 17070589
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 18633961 - 18633905
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctgg |
18633905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 25561705 - 25561761
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgg |
25561761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 26071290 - 26071346
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 26071613 - 26071561
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 28871995 - 28871939
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 322 - 390
Target Start/End: Original strand, 29855692 - 29855760
Alignment:
| Q |
322 |
caaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatga |
390 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||| | ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
29855692 |
caaatatgtctcgttttgattttggtctctgacctcacttttgtgatgatttgcacacgcggcacatga |
29855760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 38786158 - 38786214
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
38786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40029140 - 40029196
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg |
40029196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40167785 - 40167841
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| | ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 349
Target Start/End: Complemental strand, 9588598 - 9588559
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9588598 |
ttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 20661311 - 20661256
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 345
Target Start/End: Complemental strand, 25562002 - 25561951
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25562002 |
ctaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 26133183 - 26133238
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 35609303 - 35609358
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 38555013 - 38554931
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| |||| || | ||| ||||||||| |||||||||| || |||||||||| |
|
|
| T |
38555013 |
ttttgatccctgcaattatgtctcgttttggttttggtccttgacctcagttttgtgatgatttgcacac-tgacacatgatga |
38554931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 10409328 - 10409270
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
10409328 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgg |
10409270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 296 - 350
Target Start/End: Original strand, 20416359 - 20416413
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 34125305 - 34125359
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| | ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34125305 |
taggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 299 - 345
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 293 - 351
Target Start/End: Complemental strand, 38555087 - 38555030
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
38555087 |
tctaggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 39379237 - 39379295
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||| |||||| || |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39379237 |
taggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgg |
39379295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 39379612 - 39379558
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 345
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 293827 - 293880
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3851331 - 3851274
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 5904006 - 5904063
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
5904006 |
taggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 291 - 352
Target Start/End: Original strand, 10830523 - 10830584
Alignment:
| Q |
291 |
tatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||| ||||||||||| || |||||||| || |||||||||||||| |||| |
|
|
| T |
10830523 |
tatctaggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 12144905 - 12144962
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
12144905 |
taggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 13990896 - 13990843
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13990896 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 353
Target Start/End: Original strand, 15635379 - 15635432
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctgg |
15635432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 17070865 - 17070808
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
17070865 |
taggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctg |
17070808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 353
Target Start/End: Original strand, 29151507 - 29151572
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| | ||||||||| || |||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29151507 |
ttatattttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgg |
29151572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 29151852 - 29151795
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctgg |
29151795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 29875399 - 29875456
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctgg |
29875456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 32888760 - 32888836
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtcc-------cacttttgtgatgatttacacacgtggcacatgatga |
32888836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 9179592 - 9179648
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 9179921 - 9179865
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctg |
9179865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 11799128 - 11799184
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 351
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||| || |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 34125633 - 34125577
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 316 - 391
Target Start/End: Complemental strand, 5904294 - 5904219
Alignment:
| Q |
316 |
tccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||| ||| | ||||||||||||| ||||||| ||||| || ||||| |
|
|
| T |
5904294 |
tccctgcaaatatatcttgttttggttttggtcactgacctcacttttgtgatgatttgcatacgtgacatatgat |
5904219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 21050913 - 21050858
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 301 - 352
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 38182088 - 38182041
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38182088 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 38189043 - 38189090
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38189043 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Complemental strand, 38209314 - 38209267
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38209314 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 343
Target Start/End: Original strand, 38216268 - 38216315
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38216268 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 40038858 - 40038803
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 341
Target Start/End: Original strand, 4736203 - 4736249
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggt |
341 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
4736203 |
taggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 346
Target Start/End: Original strand, 35166910 - 35166960
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttag |
346 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
35166910 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 36278079 - 36278133
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| || |||| |||||||||| |
|
|
| T |
36278079 |
taggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 38554749 - 38554800
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
38554749 |
taggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtc |
38554800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 40038492 - 40038542
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||| ||||| |
|
|
| T |
40038492 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 42596521 - 42596607
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||||| |||| |||| ||| |||||||||||| ||||| |||| || |||||||| |
|
|
| T |
42596521 |
tttgtttttggtcactgcaaatatgcctcgttttgattttggtccttggtcccacttttgtgatgatttggacacatgacacatgat |
42596607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 288 - 345
Target Start/End: Original strand, 18286419 - 18286476
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||| |||||| |||||| ||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
18286419 |
ttatttctaggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| || ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 25779164 - 25779107
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
25779164 |
taggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 28871635 - 28871692
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| || ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28871635 |
taggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 29693091 - 29693038
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 391
Target Start/End: Original strand, 42553717 - 42553798
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| ||| ||| | |||||| ||| ||||||||||||| |||||||| |
|
|
| T |
42553717 |
ttttggtccctacaaatatgtctcgttttgattttggtctctgaccccactttacagatgatttgcacacgtgacacatgat |
42553798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 3850299 - 3850355
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttgg-ttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg |
3850355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 20683746 - 20683802
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 27916761 - 27916713
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 393
Target Start/End: Original strand, 28107919 - 28107955
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28107919 |
cacttttgtgatgatttgcacacgtggcacatgatga |
28107955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 42596452 - 42596508
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
42596452 |
aggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctg |
42596508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 297 - 345
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 350
Target Start/End: Complemental strand, 20418013 - 20417963
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||| |||||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 27916482 - 27916516
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27916482 |
cctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 29855614 - 29855668
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| || ||||||||| || ||||||| ||| |||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 348
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 32109098 - 32109042
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| || || |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32109098 |
taggctaatatatgattttggtcg-tgcaaatatgtttcgttttggttttagtccctg |
32109042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| |||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 7075855 - 7075811
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| | ||||||||| |
|
|
| T |
7075855 |
tagtccctggctccacttttgtgatgatttgcatatgtggcacat |
7075811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 288 - 352
Target Start/End: Original strand, 21050566 - 21050630
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| | ||||||||| || |||| |||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
21050566 |
ttatatatcggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctg |
21050630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 357 - 393
Target Start/End: Original strand, 35609393 - 35609429
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
35609393 |
cacttttgtgatgatttgcacacgtgacacatgatga |
35609429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 233)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 2481266 - 2481349
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
2481349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 15842534 - 15842617
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
15842617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 29859560 - 29859643
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
29859643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 33576078 - 33575990
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33576078 |
tttggttttagtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
33575990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 146399 - 146482
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
146482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 16673484 - 16673567
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
16673567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 24358872 - 24358789
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
24358789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 40125039 - 40125122
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
40125122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 41451910 - 41451993
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41451910 |
ttttgatccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
41451993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 43672000 - 43672088
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43672000 |
tttgtttttggtccctgcaaatatgtttcgttttggttttcgtccctggccccacttttgtgattatttgcacacgtggcacatgatga |
43672088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4423968 - 4424051
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
4424051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 14003482 - 14003565
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14003482 |
ttttggtccctgcaaatatgtctcattttagttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
14003565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 20131390 - 20131473
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccaattttgtgataatttgcacacgtgtcacatgatga |
20131473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 23732256 - 23732173
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgatgatttgcacacgtggcacatgatga |
23732173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 25705376 - 25705293
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgacaatttgcacacgtgtcacatgatga |
25705293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 30215495 - 30215578
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgtacacgtgtcacatgatga |
30215578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 16523057 - 16523145
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||| |||||| ||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16523057 |
tttgtttttggtccctgcaaatatgcctcgtttaggttttggtccctggcgccacttttgtgatgatttgcacacgtggcacatgatga |
16523145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 1138055 - 1138138
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccccgaccccacttttgtgatgatttgcacacgtggcacatgatga |
1138138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5334967 - 5334884
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgcgataatttgcacatgtgtcacatgatga |
5334884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 10671698 - 10671786
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||||||| |||||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10671698 |
tttgtttttggtccctgcaaatatgcttcattttggttttggtccctggctccacttttctgatgatttgcacacgtggcacatgatga |
10671786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 4042817 - 4042734
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||| ||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
4042817 |
ttttggtccctacaaatatgcctcattttggttttggtccctgacttcacttttgtgatgatttgcacacgtgacacatgatga |
4042734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4794203 - 4794286
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| ||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttatgatgatttacacacgtggcacatgatga |
4794286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 5164423 - 5164340
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||| |||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
5164423 |
ttttggtccatgcaaatatgtctcgttttggttttggtctctggtctcacttttgtgatgatttgcacacgtgacacatgatga |
5164340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 29182241 - 29182324
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||| || |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
29182241 |
ttttggtccatgcaaatatgtatcgttttggttttcgtccctgactccacttttgtgatgatttgcacacgtgacacatgatga |
29182324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31909406 - 31909323
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31909406 |
ttttggtccctgcaaatatgtctaattttggttttggtccctggccccacttttgtgatgatttgcacacgtgacacatgatga |
31909323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 294 - 352
Target Start/End: Original strand, 13215057 - 13215115
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13215057 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 13215367 - 13215269
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||| ||| || | ||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
13215367 |
taggctaaaatatgggtttggtccctgcaaatatgtctcgttttggttttggtcattgaccccacttttatgatgatttgcacatgtggcacatgatga |
13215269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 20131315 - 20131372
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20131315 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 41451835 - 41451892
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41451835 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 44559060 - 44559117
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559060 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 3832339 - 3832427
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||| ||| ||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
3832339 |
tttgtttttagtccctgcaaatatgtctcattttggttttggtctctggccccacttttgtgatgatttgcacacgtgacacatgatga |
3832427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4424186 - 4424130
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 25705084 - 25705140
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 33576118 - 33576062
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 38231499 - 38231587
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| || ||| | |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38231499 |
tttgtttttggtccctgcaaatatgtctcgttttgattttgttctctgaccccacttttgtgataatttgcacatgtggcacatgatga |
38231587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 18113162 - 18113245
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||| |||||| |||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
18113162 |
ttttggtccctgcaaatatgcctcattttggttttggtcactggctccacttttgtgatgatttacacacgtagcacatgatga |
18113245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 34317871 - 34317954
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||| ||||| |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34317871 |
ttttggtccctgcaaatatgcctcattttggttttggtctctggccccacttttgtgatgatttgcacacgtgacacatgatga |
34317954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 389
Target Start/End: Original strand, 42695941 - 42696020
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatg |
389 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
42695941 |
ttttggtccctgcaaatatgtctcattttggttttggtccttggccccacttttgtgatgatttgcacacgtgacacatg |
42696020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 44559336 - 44559253
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| || ||||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
44559336 |
ttttggtccctgcaaatatgtctcattttggttttgatccctgactccacttttctgatgatttgcacacgtgacacatgatga |
44559253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 297 - 351
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 10671628 - 10671685
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 11788418 - 11788361
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 16523327 - 16523270
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16523327 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 19183781 - 19183838
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
19183838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 24358614 - 24358671
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24358614 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 25705451 - 25705394
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25705451 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 33575750 - 33575807
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33575750 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 2481558 - 2481502
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 4423894 - 4423950
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 7121024 - 7121108
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| |||| ||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
7121024 |
ttttggtcattgcaaatatgtctcattttggttttggtccatggtctcacttttgtgatgatttgcacacgtgacacatgatgat |
7121108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 14003743 - 14003687
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 15842824 - 15842768
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 16522990 - 16523046
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 16673410 - 16673466
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 17302144 - 17302088
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 26813866 - 26813922
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
26813922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 29859873 - 29859817
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 31644840 - 31644892
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 146690 - 146635
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 1295474 - 1295391
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||| |||||||||||||| ||||||||||| |||||| || |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1295474 |
tttttgtcactgcaaatatgtcttgttttggttttgatccctgactccacttttgtgatgatttgcacatgtggcacatgatga |
1295391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 1696195 - 1696277
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| ||||||| | ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
1696195 |
ttttagtccctgcaaata-gtctcgttttggttttggtccctgacctcacttttgtgatgatttaaacacgtggcacatgatga |
1696277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 11713485 - 11713540
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 352
Target Start/End: Complemental strand, 26239164 - 26239105
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26239164 |
tctaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 36622250 - 36622305
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 301 - 352
Target Start/End: Complemental strand, 36806892 - 36806841
Alignment:
| Q |
301 |
aaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 37911047 - 37910964
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| ||||||| || |||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
37911047 |
ttttggtccatgcaaatatgcctcattttggttttggtccctgactccacttttgtgatgatttgcacatgtggcatatgatga |
37910964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 10671943 - 10671889
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 38639410 - 38639468
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgg |
38639468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 286 - 352
Target Start/End: Complemental strand, 40302350 - 40302284
Alignment:
| Q |
286 |
ttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||| ||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40302350 |
ttttttatataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 1138361 - 1138304
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1138361 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 14003407 - 14003464
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14003407 |
taggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 15842459 - 15842516
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15842459 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 16673773 - 16673716
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
16673773 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 16900207 - 16900150
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
16900150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 16993598 - 16993541
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
16993541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 19184152 - 19184095
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
19184095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 26814230 - 26814173
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
26814173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 30215873 - 30215816
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
30215873 |
taggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 37271738 - 37271795
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
37271795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 37272103 - 37272046
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
37272046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 38980254 - 38980197
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
38980197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 348
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 44985986 - 44985929
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44985986 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2481192 - 2481248
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 18113088 - 18113144
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24358946 - 24358890
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24483892 - 24483836
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 337 - 393
Target Start/End: Original strand, 27109142 - 27109198
Alignment:
| Q |
337 |
ttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27109142 |
ttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
27109198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 30215421 - 30215477
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 33732861 - 33732917
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33732861 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33732917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 35686273 - 35686185
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||| ||| |||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
35686273 |
tttgtttttggtccctgcaaatatgatgcgttttggttttggtcattggccccacttttgtgatgatttgcacacgtagcacatgatga |
35686185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 36815836 - 36815780
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 37228732 - 37228784
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 378
Target Start/End: Original strand, 37228795 - 37228863
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| | |||||||||||| ||||||||| |
|
|
| T |
37228795 |
ttttggtccctgcaaatgtgtctcgttttggttttggtccctgaccccacttttgtgatgatttgcaca |
37228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 41693673 - 41693729
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 9195054 - 9195109
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 10375069 - 10375014
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg |
10375014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 20939252 - 20939169
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| ||||| |||||| |||| |||||||||| ||||||| | |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
20939252 |
ttttgggccctgtaaatatttctcattttggttttggtccctgaccccacttttgtgatgatttacacacgtggcacatgatga |
20939169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 34317798 - 34317853
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 318 - 393
Target Start/End: Complemental strand, 34964080 - 34964005
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||| ||||||||| || ||||||||||||| |||||||||| |
|
|
| T |
34964080 |
cctgcaaatatgcctcgttttggttttggtctctggccccacttttgtaatgatttgcacacgtgacacatgatga |
34964005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 34964159 - 34964104
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 351
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 43788856 - 43788910
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43788856 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 3832639 - 3832586
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3832639 |
taggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 4042609 - 4042662
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 351
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 9195208 - 9195151
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 10664982 - 10665039
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
10664982 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctg |
10665039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 305 - 394
Target Start/End: Original strand, 13850589 - 13850677
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||| |||| ||| ||||||||||||||||||| |||||| ||||| | | |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
13850589 |
tttgttttttgtctctgcaaatatgtctcgtttgggttttggtccc-gaccccacttttgtgatgatttgcacacgtgacacatgatgat |
13850677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 17541381 - 17541438
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctgg |
17541438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 17541777 - 17541724
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17541777 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 22881612 - 22881665
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 40786458 - 40786515
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
40786458 |
taggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 43592044 - 43592101
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 43597152 - 43597209
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
43597152 |
taggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 44073808 - 44073751
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44073808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgg |
44073751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 44985623 - 44985676
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44985676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 2265398 - 2265342
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 3837932 - 3837988
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 5790558 - 5790614
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| |||| || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctgg |
5790614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 8046328 - 8046384
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 11713846 - 11713790
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
11713790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 25750898 - 25750810
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| |||| ||||||| |||||||| |||| |||| || | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25750898 |
tttgtttttggtacctgtaaatatggttcgttttgattttcgtccttgaccccacttttgtgatgatttgcacacgtggcacatgatga |
25750810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 26238816 - 26238868
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26238868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 27311071 - 27311015
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 32476094 - 32476150
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 35155620 - 35155564
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 288 - 352
Target Start/End: Original strand, 36815479 - 36815543
Alignment:
| Q |
288 |
ttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||| |||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
36815479 |
ttatatataggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctg |
36815543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 36815762 - 36815678
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtcc-ctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| ||| ||| ||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
36815762 |
ttttggtccctgcaaatatgcctcattttgattttggtcatctgactttacttttgtgatgatttgcacacgtgacacatgatga |
36815678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 37911121 - 37911065
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 38731828 - 38731884
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38731884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 43597500 - 43597444
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
43597444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 43672319 - 43672263
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 3671192 - 3671137
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 8046648 - 8046593
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 289 - 352
Target Start/End: Original strand, 10374766 - 10374829
Alignment:
| Q |
289 |
tatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| || |||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10374766 |
tatatatatgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 35155365 - 35155448
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| ||| | |||||||| ||| ||||||||| ||| |||||||||| |
|
|
| T |
35155365 |
ttttggtccctgcaaatatgcttcgttttggttttggtctctgaccccacttttgggatgatttgcacatgtgccacatgatga |
35155448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 40124966 - 40125021
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 41694003 - 41693948
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 298 - 349
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 3838263 - 3838209
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
3838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 302 - 348
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 11788121 - 11788206
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| ||| ||| | | |||||||||| ||||||||| ||| |||||||| |
|
|
| T |
11788121 |
tttgtttttggtcgctgcaaatatgtctcgttttggttttggtctctgac-ccccttttgtgatgatttgcacatgtgacacatgat |
11788206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 17912447 - 17912505
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||| |||||| || |||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctgg |
17912505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 294 - 352
Target Start/End: Original strand, 20658058 - 20658116
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
20658058 |
ctaggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20658116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 35155302 - 35155344
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35155302 |
tggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 3172019 - 3172072
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 3172533 - 3172480
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 3671001 - 3671058
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
3671001 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 7814245 - 7814302
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| | ||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
7814302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 7814739 - 7814682
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
7814739 |
taggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
7814682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13850520 - 13850577
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | |||||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
13850520 |
taggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctg |
13850577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 315 - 352
Target Start/End: Complemental strand, 22881950 - 22881913
Alignment:
| Q |
315 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
22881913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 23989836 - 23989889
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 25954114 - 25954167
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 290 - 343
Target Start/End: Original strand, 29831807 - 29831860
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttt |
343 |
Q |
| |
|
||||| |||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
29831807 |
atatcaaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 29865513 - 29865456
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
29865513 |
taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctg |
29865456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 31909480 - 31909428
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 38979889 - 38979946
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatat-gtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctgg |
38979946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 43789193 - 43789136
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctgg |
43789136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 45442697 - 45442644
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| || |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 1295544 - 1295492
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg |
1295492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 23732329 - 23732274
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg |
23732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 27310875 - 27310930
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg |
27310930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 40125290 - 40125234
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 40301974 - 40302030
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctg |
40302030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Complemental strand, 44994062 - 44994010
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 1497610 - 1497665
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 12835325 - 12835380
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 18113454 - 18113399
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 31226077 - 31226022
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg |
31226022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 347
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||| |||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 291 - 353
Target Start/End: Complemental strand, 2412493 - 2412431
Alignment:
| Q |
291 |
tatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
2412493 |
tatctaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctgg |
2412431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 323 - 393
Target Start/End: Original strand, 3172104 - 3172174
Alignment:
| Q |
323 |
aaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | || |||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
3172104 |
aaatatgtctcgttttggttttggtccctgaccccatttttatgatgatttgcacatgtggcgcatgatga |
3172174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 24483401 - 24483455
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||| ||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg |
24483455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 348
Target Start/End: Original strand, 26709693 - 26709747
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||||| || |||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
26709693 |
ctaggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 353
Target Start/End: Complemental strand, 17912808 - 17912755
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| || |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctgg |
17912755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 344
Target Start/End: Complemental strand, 20658411 - 20658362
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20658411 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 26707871 - 26707928
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26707871 |
taggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg |
26707928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 32691311 - 32691368
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
32691311 |
taggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg |
32691368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 37910754 - 37910811
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||| ||| |||| ||||||||||||| |
|
|
| T |
37910754 |
taggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg |
37910811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 38732135 - 38732078
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||||| |||| ||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
38732135 |
taggttaaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctg |
38732078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 351
Target Start/End: Original strand, 43710394 - 43710435
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43710394 |
ttttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 341 - 393
Target Start/End: Original strand, 4842935 - 4842987
Alignment:
| Q |
341 |
ttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| || |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
4842935 |
ttttggtccctgactccacttttgtgatgattttcacacgtggcacatgatga |
4842987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| |||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| |||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| |||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| |||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 29182167 - 29182219
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
29182167 |
aggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtc |
29182219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 31225714 - 31225770
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 31326253 - 31326197
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| |||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg |
31326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 43671933 - 43671989
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| |||||||||||||||| |||| |
|
|
| T |
43671933 |
aggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 43710709 - 43710653
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| || |||| | || |||||||||| |||||||||||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 318 - 349
Target Start/End: Complemental strand, 14393108 - 14393077
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14393108 |
cctgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 17301983 - 17302036
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| |||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
17301983 |
aggctaaaatatggttttggtcc-tgaaaatat-tctcgttttggttttagtccct |
17302036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 305 - 344
Target Start/End: Original strand, 29831880 - 29831919
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggtttt |
344 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
29831880 |
tttgtttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 31325920 - 31325975
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||| | ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 348
Target Start/End: Original strand, 1295196 - 1295234
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
1295196 |
ttttggtccatgtaaatatgtctcgttttggttttagtc |
1295234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 393
Target Start/End: Original strand, 3172252 - 3172322
Alignment:
| Q |
323 |
aaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| | |||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
3172252 |
aaatatgcctcgttttggttttggtccctggccctatttttatgatgatttgcacatgtggcgcatgatga |
3172322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 44993824 - 44993858
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
44993824 |
cctgcaaatatgtctcgttttggttttactccctg |
44993858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 10665295 - 10665239
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | ||||| ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #227
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 17541670 - 17541626
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||||||||||| |
|
|
| T |
17541670 |
tagtccctgactccacttttgtgatgatttgcatacgtggcacat |
17541626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #228
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 19604978 - 19604922
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| || |||||||||||| ||||||| ||| ||| |||||| |||||||| |
|
|
| T |
19604978 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctgg |
19604922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #229
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #230
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 26238917 - 26238961
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
26238917 |
tagtccctggccccacttttgtgatgatttgcatacgtggcacat |
26238961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #231
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Complemental strand, 35686340 - 35686288
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||| |||||| |||||||| |||||| ||||||| |||||||||||||||| |
|
|
| T |
35686340 |
taggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #232
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 43710485 - 43710529
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
43710485 |
tagtccctgacctcacttttgtgatgatttgcatacgtggcacat |
43710529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #233
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 44073700 - 44073656
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
44073700 |
tagtccctgacctcacttttgtgataatttgcatacgtgacacat |
44073656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 256)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 16026865 - 16026782
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
16026782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 33000596 - 33000513
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
33000513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 38150921 - 38151004
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtggcacatgatga |
38151004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 38164004 - 38164087
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggcttcacttttgtgataatttgcacacgtgtcacatgatga |
38164087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 3247489 - 3247406
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
3247406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 19721001 - 19720918
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtggcacatgatga |
19720918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 24507552 - 24507635
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
24507635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 30323220 - 30323137
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
30323137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 31061078 - 31060995
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
31060995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 35056821 - 35056738
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
35056738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 38136908 - 38136825
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
38136825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 40718401 - 40718318
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
40718318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 45380345 - 45380428
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
45380428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 10887306 - 10887389
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
10887389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 24977852 - 24977935
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggttttggtccctagctccacttttgtgatgatttgcacacgtggcacatgatga |
24977935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 45638653 - 45638736
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgtacacgtgtcacatgatga |
45638736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 295 - 393
Target Start/End: Complemental strand, 8364918 - 8364820
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||||||||||||||| ||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
8364918 |
taggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctgaccccacttttgtgatgatttgcacacgtgacacatgatga |
8364820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 8140726 - 8140642
Alignment:
| Q |
310 |
ttttggtccctgcaaa-tatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8140726 |
ttttggtccctgcaaaatatgtctcattttggttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
8140642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 33234615 - 33234703
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| |||| |||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33234615 |
tttgtttttgatccctgcaaatatgtctcgttttgattttggtccctggctccacttttgtgatgatttgcacatgtggcacatgatga |
33234703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 10631455 - 10631372
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10631455 |
ttttggtctctgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacacgtgtcacatgatga |
10631372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 16060668 - 16060751
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| |||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16060668 |
ttttggtccctgcaaatatgcctcattttgattttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
16060751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 17130011 - 17129928
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| || |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctgactccacttttgtgatgatttgcacacgtggcagatgatga |
17129928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 44157969 - 44157886
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44157969 |
ttttggtccctgcaaatatgcctcattttggttttggtccttggctccacttttgtgatgatttgcacacgtggcacatgatga |
44157886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 47819305 - 47819388
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggttttggtccctggctccacttttgcgataatttgcacatgtgtcacatgatga |
47819388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 300 - 393
Target Start/End: Original strand, 39025112 - 39025205
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||| |||| |||| |||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtccatggccccacttttgtgatgatttgcactcgtgacacatgatga |
39025205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 18079472 - 18079555
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18079472 |
ttttggtccctgtaaatatgcctcgttttggttttggtctctggccccacttttgtgatgatttgcacacgtggcacatgatga |
18079555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 33045429 - 33045512
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33045429 |
ttttggtccctgcaaatatgcatcattttggttttggtccatggctccacttttgtgatgatttgcacacgtggcacatgatga |
33045512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 39747546 - 39747629
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||| |||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39747546 |
ttttggtccctgcaaatatgccttattttggttttggtcccgggctccacttttgtgatgatttgcacacgtggcacatgatga |
39747629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 8140432 - 8140489
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8140432 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 39747837 - 39747780
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39747837 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 45380270 - 45380327
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380270 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 3247197 - 3247253
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 10887600 - 10887544
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10887600 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 12360969 - 12360913
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 15526363 - 15526307
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 19720711 - 19720767
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 24654094 - 24654010
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg-gcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | ||||| ||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
24654094 |
ttttggtccctgcaaatatgtctcattttggttttggcccctgcgctccaattttgtgataatttgcacacgtgtcacatgatga |
24654010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 30322928 - 30322984
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 33000670 - 33000614
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 7350663 - 7350581
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctggccccacttttgtgatgatttgca-acgtggcacatgatga |
7350581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 10631164 - 10631219
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 305 - 392
Target Start/End: Original strand, 15466200 - 15466287
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| ||| || | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15466200 |
tttgtttttggtccctgcaaatatgtctcgttttagttttgatccatgtccccacttttgtgatgatttgcacacgtggcacatgatg |
15466287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 15516655 - 15516738
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||| | ||||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15516655 |
ttttgatcccagaaaatatgtctcattttagttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
15516738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 385
Target Start/End: Original strand, 18208756 - 18208831
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggca |
385 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||| |||| ||||||||||||| |||||||||||||||| |
|
|
| T |
18208756 |
ttttggtccctacaaatatgcctcgttttggttttggtccatggcatcacttttgtgatgatttgcacacgtggca |
18208831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 18927850 - 18927933
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| ||| | |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
18927850 |
ttttggtccctgcaaatatgtttcgttttggttttggtctctgaccccacttttgtgatgatttacacacgtggcacatgatga |
18927933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 26324874 - 26324791
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||| |||||||||| || ||||| |||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctgaccccacttttgtgatgatttgcacacatgtcacataatga |
26324791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 51986503 - 51986420
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |||||| || |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
51986503 |
ttttggtccctgcaaatatgtttcgttttgattttcgtccctagccccacttttgtgatgatttgcacacgtgacacatgatga |
51986420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 10887231 - 10887288
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 13260323 - 13260266
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 21391094 - 21391151
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 33045353 - 33045410
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
33045353 |
taggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 393
Target Start/End: Original strand, 34002634 - 34002731
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| | || ||||||||||||||||||||||||||||||||||| ||| | | ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggttttggtctataaccccacttttgtgacgatttgcacacgtggcacatgatga |
34002731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 393
Target Start/End: Complemental strand, 42483272 - 42483175
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| | ||||||||||| || | || | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttcttgaccccacttttgtgatgatttgcacacgtgtcacatgatga |
42483175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 45290456 - 45290513
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
45290513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 47819230 - 47819287
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47819230 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 6567497 - 6567441
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 10631529 - 10631473
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 14007488 - 14007544
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14007544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 19622653 - 19622709
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24507844 - 24507788
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24654168 - 24654112
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 313 - 393
Target Start/End: Complemental strand, 25658226 - 25658147
Alignment:
| Q |
313 |
tggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||| ||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25658226 |
tggtccctgcaaatatgcctcattttggttttggtccatggctccacttttgtgatgatttgcaca-gtggcacatgatga |
25658147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 33045691 - 33045635
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 388
Target Start/End: Original strand, 35005443 - 35005535
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| | | ||||||||| ||||||| ||||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgaccctagttttgtgatgatttgcatacgtggcacat |
35005535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 38164296 - 38164240
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 47819597 - 47819541
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 4789381 - 4789464
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| ||||||| | |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
4789381 |
ttttggtccccgcaaatatgtctcgttttgattttggtccctgaccccacttttgtgatgatttaaacacgtggcacatgatga |
4789464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 293 - 352
Target Start/End: Complemental strand, 11822369 - 11822310
Alignment:
| Q |
293 |
tctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11822369 |
tctaggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 12322970 - 12322915
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 12360676 - 12360759
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| ||||||| | |||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
12360676 |
ttttgatccctgcaaatatgtcccgttttggttttggtccctgaccccacttttgtgatgatttgcacatgtggcacataatga |
12360759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 285 - 352
Target Start/End: Original strand, 13770477 - 13770544
Alignment:
| Q |
285 |
tttttatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||| ||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13770477 |
ttttaatatataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13770544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 289 - 352
Target Start/End: Complemental strand, 35056902 - 35056839
Alignment:
| Q |
289 |
tatatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35056902 |
tatatataggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 38151212 - 38151157
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 990381 - 990323
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
990381 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
990323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Original strand, 18473270 - 18473328
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18473270 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
18473328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 305 - 391
Target Start/End: Complemental strand, 19198881 - 19198795
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| ||||||| |||||||||||| ||||||||||||| ||| ||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
19198881 |
tttgtttttggttcctgcaaatatgcttcgttttggttttggtctctgaccccacttttgtgatgatttgcacacgtggcacatgat |
19198795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 41358665 - 41358607
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgg |
41358607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 345
Target Start/End: Complemental strand, 45638896 - 45638846
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45638896 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3247564 - 3247507
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3247564 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 15516580 - 15516637
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15516580 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 16026940 - 16026883
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16026940 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 22919682 - 22919739
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22919682 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22919739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 26061955 - 26062012
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
26062012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 26324583 - 26324640
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26324583 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 30323295 - 30323238
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30323295 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 32729050 - 32728993
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
32728993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 393
Target Start/End: Original strand, 37624745 - 37624842
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||| | ||||||||||||||| |||||||||||||| |||| | | ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtccataaccctacttttgtgatgatttgcacacgtggcacatcatga |
37624842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 41358368 - 41358425
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
41358425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 41881092 - 41881149
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctgg |
41881149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 42482977 - 42483030
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42482977 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 48609596 - 48609543
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 1810926 - 1810982
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 7001897 - 7001841
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgg |
7001841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 7867358 - 7867302
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 8140800 - 8140744
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 15211510 - 15211562
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 378
Target Start/End: Complemental strand, 15211783 - 15211715
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcaca |
378 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||| || ||||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctggccccacttttgttatgatttgcaca |
15211715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 18302388 - 18302332
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 24510010 - 24510098
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||| | ||||||| | |||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
24510010 |
tttgtttttggtccctgcaaatatgacgcgttttggttgtggtccctgaccccacttttgtgatgatttgcagatgtggcacatgatga |
24510098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 29072496 - 29072552
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29072552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 31061152 - 31061096
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 32035727 - 32035639
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||| |||| |||| |||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
32035727 |
tttgtttttggtccctacaaatatgtctcgcgttggttttggtccttggccccacttttgtgatgatttgtacacgtgacacatgatga |
32035639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 32626528 - 32626584
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 33234545 - 33234601
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 34002941 - 34002885
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 45368489 - 45368545
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 46183757 - 46183845
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttca-----cttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctggctccaattttattttgtgatgatttgcacacgtggcacatgatga |
46183845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 353
Target Start/End: Complemental strand, 46868577 - 46868521
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 48609235 - 48609291
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 310 - 390
Target Start/End: Complemental strand, 49073980 - 49073900
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatga |
390 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||| ||||||| | |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
49073980 |
ttttggtccttgcaaatatgcctcattttggttttggtccctgaccccacttttgtgatgatttgcacacgtgtcacatga |
49073900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 305 - 392
Target Start/End: Complemental strand, 4617325 - 4617238
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatg |
392 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||||| ||||| | ||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
4617325 |
tttgtttttgatccctgcaaatatgtcttgttttggttttgatccctaacatcacttttgtgatgatttacacacatggcacatgatg |
4617238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 298 - 349
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 16060885 - 16060830
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 18473596 - 18473541
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 20948755 - 20948810
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 25658014 - 25658069
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 33379887 - 33379942
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 35308111 - 35308056
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35308056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 41738869 - 41738952
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||| || ||||||| ||||||||||||||| ||| || || ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
41738869 |
ttttggtctctacaaatatatctcgttttggttttggtctcttgccccacttttgtaatgatttgcacacgtggcacatgatga |
41738952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 49073690 - 49073745
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 3753214 - 3753268
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3753268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 299 - 345
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 310 - 368
Target Start/End: Complemental strand, 20949008 - 20948950
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgat |
368 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
20949008 |
ttttggtccgtgcaaatatgtctcattttggttttggtctctggcttcacttttgtgat |
20948950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 35005746 - 35005692
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35005746 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 352
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 353
Target Start/End: Complemental strand, 45290822 - 45290764
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45290822 |
taggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctgg |
45290764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 990087 - 990144
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgg |
990144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 4565338 - 4565281
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4565338 |
taggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 7867127 - 7867184
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 11822003 - 11822056
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 13259986 - 13260043
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg |
13260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 19623018 - 19622961
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgg |
19622961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 21383102 - 21383159
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21383102 |
taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
21383159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 22674201 - 22674254
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22674201 |
taggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 297 - 346
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttag |
346 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 28507460 - 28507403
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
28507460 |
taggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 31258338 - 31258395
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgg |
31258395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 32454296 - 32454239
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32454296 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctg |
32454239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 34808195 - 34808252
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| |||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34808195 |
taggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 298 - 351
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 50429211 - 50429154
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
50429154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 50799128 - 50799185
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 3679625 - 3679681
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
3679681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 3753573 - 3753517
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 12361010 - 12361066
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctg |
12361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 18900130 - 18900078
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
18900078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 26442900 - 26442844
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
26442844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 318 - 394
Target Start/End: Original strand, 26699371 - 26699447
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||| || ||| || |||||||||||| |||| | |||||| ||||||||||| |
|
|
| T |
26699371 |
cctgcaaatatgtctcgttttggttttgatctctgactccacttttgtgatgatttacgcacgtgacacatgatgat |
26699447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 35307714 - 35307770
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 36912851 - 36912895
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttg |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36912851 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 39747473 - 39747528
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 5058798 - 5058881
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||| ||| ||| | ||||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
5058798 |
tttttgtccctccaaatatgtctcgttttagttttggtcactgaccccacttttatgatgatttgcacatgtggcacatgatga |
5058881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 347
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 28507188 - 28507271
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||| || ||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggttttggtctctgatcccaattttgtgatgatttgcacatgtgacacatgatga |
28507271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 29072862 - 29072807
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 29688429 - 29688374
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 310 - 385
Target Start/End: Original strand, 32420170 - 32420245
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggca |
385 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||| | ||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
32420170 |
ttttggtccttacaaatatgcctcgttttggttttggaccctgaccccacttttgtgatgatttgcacacgtggca |
32420245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 290 - 349
Target Start/End: Original strand, 33067341 - 33067400
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||| ||||||||||| ||||||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
33067341 |
atatttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 33234912 - 33234857
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 41738796 - 41738851
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 296 - 351
Target Start/End: Complemental strand, 44158043 - 44157988
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 44641432 - 44641377
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
44641377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 299 - 350
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 48956066 - 48956011
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
48956011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 52254479 - 52254424
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 290 - 348
Target Start/End: Complemental strand, 7819110 - 7819052
Alignment:
| Q |
290 |
atatctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
7819110 |
atatctaggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 319 - 393
Target Start/End: Original strand, 22674285 - 22674359
Alignment:
| Q |
319 |
ctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||| |||||||||||| |||| || |||||||||||||| |
|
|
| T |
22674285 |
ctgcaaatatgtctcgtttttgttttagtctctggccccacttttgtgatgatttacagttgtggcacatgatga |
22674359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 349
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 12360601 - 12360658
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||| |||| ||||||| ||||| |
|
|
| T |
12360601 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 315 - 352
Target Start/End: Original strand, 18302071 - 18302108
Alignment:
| Q |
315 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18302071 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
18302108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 24649662 - 24649605
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| ||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
24649662 |
taggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 30962414 - 30962471
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30962414 |
taggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 300 - 353
Target Start/End: Complemental strand, 31258699 - 31258646
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctgg |
31258646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 31404724 - 31404667
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||| | ||||||||||||| |
|
|
| T |
31404724 |
taggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 52254182 - 52254235
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 4360627 - 4360571
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg |
4360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Original strand, 8364619 - 8364667
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 12322604 - 12322656
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 16060595 - 16060646
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 348
Target Start/End: Original strand, 17984332 - 17984384
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 18079397 - 18079453
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 350
Target Start/End: Complemental strand, 18928141 - 18928089
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccc |
350 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| |||| ||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtccc |
18928089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 26191359 - 26191411
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 50428872 - 50428928
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 3679986 - 3679931
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 15211858 - 15211803
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||||||| | |||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 16026572 - 16026627
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 32035790 - 32035747
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
32035790 |
taggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 41739122 - 41739068
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 322 - 393
Target Start/End: Complemental strand, 48730533 - 48730462
Alignment:
| Q |
322 |
caaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| || |||| ||| ||||||| | |||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
48730533 |
caaatatgtcttgtgttggctttggtccctgaccccacttttgtgatgatttgcacacgtgacacatgatga |
48730462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 302 - 352
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 298 - 348
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 302 - 352
Target Start/End: Complemental strand, 4789639 - 4789589
Alignment:
| Q |
302 |
aaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctg |
4789589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 391
Target Start/End: Original strand, 12322673 - 12322759
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgat |
391 |
Q |
| |
|
|||| |||| ||| ||||||||||| ||||||||| |||| ||| ||| | ||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
12322673 |
tttgttttttgtctctgcaaatatgcctcgttttgattttggtctctgaccccacttttatgatgatttgcacatgtggcacatgat |
12322759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 22919979 - 22919925
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
22919979 |
taggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 32035446 - 32035488
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32035446 |
tggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 299 - 349
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||| |||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 294 - 352
Target Start/End: Complemental strand, 49923821 - 49923763
Alignment:
| Q |
294 |
ctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||| || |||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
49923821 |
ctaggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Original strand, 4617086 - 4617139
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| ||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
4617086 |
taggttaaaatatggttttggtccctgaaaatatgtttcgttttagttttagtc |
4617139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 349
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 298 - 347
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 300 - 353
Target Start/End: Complemental strand, 26062255 - 26062202
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctgg |
26062202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 26324949 - 26324896
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || |||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
26324949 |
taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 32906242 - 32906189
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||| |||||| || ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
32906242 |
taggttaaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 299 - 352
Target Start/End: Complemental strand, 45368847 - 45368794
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| || |||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctg |
45368794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 351
Target Start/End: Original strand, 292869 - 292913
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
292869 |
tggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| || |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 24978123 - 24978067
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| | |||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
24978123 |
aggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 31404485 - 31404573
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||| |||||||||| |||||||| |||| ||| || || ||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
31404485 |
tttgtttttggtccttgcaaatatgcttcgttttgattttggtctctagccctacttttgtgatgattagcacacgcggcacatgatga |
31404573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 46184051 - 46183999
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctg |
46183999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 314 - 381
Target Start/End: Original strand, 15058495 - 15058562
Alignment:
| Q |
314 |
ggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgt |
381 |
Q |
| |
|
||||||| |||||||| ||| |||||||||| |||| ||| |||||||| |||| |||||||||||| |
|
|
| T |
15058495 |
ggtccctacaaatatgcctcattttggttttggtccttggtctcacttttatgatgatttgcacacgt |
15058562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttg |
339 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 298 - 345
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| | ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 352
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||| |||||||| || ||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 318 - 352
Target Start/End: Original strand, 24509963 - 24509997
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctg |
24509997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 352
Target Start/End: Complemental strand, 25658288 - 25658246
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
25658288 |
ttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 300 - 338
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgtttt |
338 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 298 - 348
Target Start/End: Complemental strand, 37625026 - 37624976
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtc |
37624976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 4617397 - 4617344
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| || ||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
4617397 |
taggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtc |
4617344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 344 - 393
Target Start/End: Original strand, 16083158 - 16083207
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||||| || ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16083158 |
tagtccctggccccatttttgtgatgatttgcatacgtggcacatgatga |
16083207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 348
Target Start/End: Complemental strand, 20949069 - 20949028
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| ||||||||| |
|
|
| T |
20949069 |
tggttttggtctctgtaaatatgtctcgttttagttttagtc |
20949028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 26699608 - 26699556
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
26699608 |
taggctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagtc |
26699556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 352
Target Start/End: Original strand, 32453956 - 32453985
Alignment:
| Q |
323 |
aaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctg |
32453985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 49923753 - 49923671
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| |||||| || ||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
49923753 |
tttgtttttggttcctgcaaatatgtctcgttttg------gtcccttgccccacttttgtgaagatttgcacatgtagcacatgatga |
49923671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 67; Significance: 1e-29; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 296 - 394
Target Start/End: Original strand, 47924 - 48022
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||| || ||| ||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgaccccacttttgtgatgatttgcacacttgacacttgatgat |
48022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 222879 - 222967
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||| || |||||||||||| || || | |||||||||||||||| |
|
|
| T |
222879 |
tttgtttttggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgatgtgtagacgtggcacatgatga |
222967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 349
Target Start/End: Complemental strand, 223174 - 223120
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
223174 |
taggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 300 - 348
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 64; Significance: 7e-28; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 75691 - 75608
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
75691 |
ttttggtccctgcaaatatgtctcttttttgttttggtccctggctccacttttgtgataatttgcacacgtgtcacatgatga |
75608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 75357 - 75414
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75357 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 75766 - 75709
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
75766 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 64; Significance: 7e-28; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 147960 - 148043
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
147960 |
ttttggtcccagcaaatatgcctcattttggttttggtccctggcttcacttttgtgatgatttgcacacgtggcacatgatga |
148043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 351
Target Start/End: Original strand, 147889 - 147941
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
147889 |
aggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagtccct |
147941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 61; Significance: 5e-26; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 310 - 394
Target Start/End: Original strand, 21763 - 21847
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| || |||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctagccccacttttgtgatgatttgcacacgtggcacgtgatgat |
21847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 22056 - 22003
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 341
Target Start/End: Original strand, 21695 - 21739
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggt |
341 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatatgt-tcgttttggt |
21739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 60; Significance: 2e-25; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 50005 - 49922
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50005 |
ttttggtccttgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacgcgtggcacatgatga |
49922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Complemental strand, 55106 - 55023
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55106 |
ttttggtccttgcaaatatgtctcattttggttttggtccctgactccacttttgtgataatttgcacgcgtggcacatgatga |
55023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 54814 - 54870
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 60; Significance: 2e-25; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 82414 - 82497
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
82414 |
ttttggtccctgcaaatatgccttattttggttttggtccctggctccacttttgtgatgatttgcacacgtggcacatgatga |
82497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 82708 - 82651
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
82708 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 82340 - 82396
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 54; Significance: 7e-22; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 27366 - 27309
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27366 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 26998 - 27042
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttg |
339 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26998 |
taggctcaaatttggttttggtccctgcaaatatgtctcgttttg |
27042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 381
Target Start/End: Original strand, 27067 - 27143
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgt |
381 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| ||||||| | |||||||||| |||||||||||| |
|
|
| T |
27067 |
tttgtttttggtccctgcaaatatgcctcgttttggttttggtccctgacacaacttttgtgacgatttgcacacgt |
27143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 16796 - 16879
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||||||| ||||||| || |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16796 |
tttttgtcactgcaaatatgtctcattttggttttggtccctgactccacttttgtgatgatttgcacatgtggcacatgatga |
16879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 16724 - 16779
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| || ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 3824 - 3906
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||| |||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
3824 |
ttttggtccatgcaaatatgtctcattttgattttggtccctggctccacttttgtgatga-ttgcacacgtggcacatgatga |
3906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 348
Target Start/End: Complemental strand, 4081 - 4028
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtc |
348 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4081 |
taggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 3750 - 3807
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
3750 |
taggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 1310 - 1367
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
1367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 1645 - 1588
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || ||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctgg |
1588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 290 - 233
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 49; Significance: 7e-19; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 318 - 394
Target Start/End: Original strand, 189409 - 189485
Alignment:
| Q |
318 |
cctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatgat |
394 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
189409 |
cctgcaaatatgactcattttggttttggtccctggccccacttttgtgatgatttgcacacgtggcatatgatgat |
189485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 61631 - 61687
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
61631 |
aggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 295 - 347
Target Start/End: Original strand, 189327 - 189379
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||||| | |||||| | |||| ||||||| ||||||||||||||||| |
|
|
| T |
189327 |
taggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagt |
189379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 310 - 393
Target Start/End: Original strand, 2576 - 2658
Alignment:
| Q |
310 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||| ||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2576 |
ttttggtacctgcaaatatgtctcgttttggtttg-gtctctgaccccacttttgtgattatttgcacacgtggcacatgatga |
2658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 297 - 351
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 295 - 351
Target Start/End: Original strand, 2499 - 2555
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2499 |
taggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 47; Significance: 1e-17; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 4039 - 4093
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 295 - 349
Target Start/End: Original strand, 19221 - 19275
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 4289 - 4236
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 19471 - 19418
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 46; Significance: 4e-17; HSPs: 3)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 14695 - 14752
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 15013 - 14957
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 344 - 388
Target Start/End: Original strand, 14802 - 14846
Alignment:
| Q |
344 |
tagtccctggcttcacttttgtgataatttgcacacgtggcacat |
388 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
14802 |
tagtccctggccccacttttgtgatgatttgcatacgtggcacat |
14846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 3293 - 3236
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3293 |
taggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
3236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 24370 - 24427
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24370 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 353
Target Start/End: Complemental strand, 5709 - 5652
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgg |
5652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 5398 - 5455
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctgg |
5455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 2777 - 2833
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 295 - 351
Target Start/End: Complemental strand, 2662 - 2606
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccct |
351 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2662 |
taggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 393
Target Start/End: Original strand, 2415 - 2451
Alignment:
| Q |
357 |
cacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2415 |
cacttttgtgatgatttgcacacgtggcacatgatga |
2451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 295 - 345
Target Start/End: Original strand, 2332 - 2382
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| || |||||||||||| |
|
|
| T |
2332 |
taggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 3919 - 3863
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 296 - 352
Target Start/End: Complemental strand, 366274 - 366218
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
366274 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
366218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 292 - 352
Target Start/End: Original strand, 365974 - 366034
Alignment:
| Q |
292 |
atctaggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||| ||||||||| ||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
365974 |
atctcggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 9028 - 8973
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 299 - 352
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| ||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 353
Target Start/End: Original strand, 8546 - 8603
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
|||||||||| || |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgg |
8603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 35086 - 35029
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| |||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
35086 |
taggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 393
Target Start/End: Complemental strand, 35017 - 34929
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| ||||| |||||| |||||||||||||||||||||| |||||||| ||||||| |||| ||||||| | ||| |||||||||| |
|
|
| T |
35017 |
tttgtttttgatccctgtaaatatgtctcgttttggttttggtccctggtcccacttttatgatgatttgcatatgtgacacatgatga |
34929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Original strand, 8329 - 8382
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 296 - 349
Target Start/End: Complemental strand, 8643 - 8590
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 10517 - 10460
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 5208 - 5264
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 296 - 352
Target Start/End: Original strand, 5228 - 5284
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 393
Target Start/End: Original strand, 7013 - 7101
Alignment:
| Q |
305 |
tttggttttggtccctgcaaatatgtctcgttttggttttagtccctggcttcacttttgtgataatttgcacacgtggcacatgatga |
393 |
Q |
| |
|
|||| |||||||| ||| ||||||||||| |||| ||||| ||| ||||| |||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
7013 |
tttgtttttggtctctgtaaatatgtctcattttagttttggtctctggccccacttttgtgatgatttgcacatgtgacacatgatga |
7101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 345
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
| Q |
296 |
aggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||||| || |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 297 - 353
Target Start/End: Original strand, 34931 - 34987
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctgg |
353 |
Q |
| |
|
||||||||| |||| || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctgg |
34987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 297 - 352
Target Start/End: Original strand, 12182 - 12237
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
12237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| || |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Complemental strand, 18045 - 17988
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
18045 |
taggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 352
Target Start/End: Original strand, 94055 - 94112
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||||| ||||||| |||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
94055 |
taggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 298 - 345
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
298 |
gctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 37; Significance: 0.000000000009; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 297 - 349
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtcc |
349 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 307 - 352
Target Start/End: Original strand, 4019 - 4064
Alignment:
| Q |
307 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4019 |
tggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 300 - 347
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
| Q |
300 |
taaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 352
Target Start/End: Complemental strand, 17966 - 17911
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
352 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||||||| ||||| |||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||||| | ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 347
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
299 |
ctaaaatttggttttggtccctgcaaatatgtctcgttttggttttagt |
347 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 328
Target Start/End: Complemental strand, 30968 - 30935
Alignment:
| Q |
295 |
taggctaaaatttggttttggtccctgcaaatat |
328 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
30968 |
taggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 297 - 345
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
297 |
ggctaaaatttggttttggtccctgcaaatatgtctcgttttggtttta |
345 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University