View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18251_low_17 (Length: 230)

Name: NF18251_low_17
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18251_low_17
NF18251_low_17
[»] chr4 (1 HSPs)
chr4 (1-212)||(32875306-32875517)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32875306 - 32875517
Alignment:
Q  1 ggagtgggttatcaatggtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgggaccctcgagttacagggtcgaaattg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  32875306 ggagtgggttatcaatggtttagagaaggaaaaaggatatcctgttgagaatgtgagtgtgtctcttggacgtgaccctcgagttacagggtcgaaattg 32875405  T
Q  101 agcgttgcagtgtttgccggtctttctcgtgctggctgtatggtgttcgatatgggactagctaccacgcctgcttgtttcatgagcacattgttgcctc 200  Q
    |||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  32875406 agcgttgcagtgtttgccggtcttgctcgtgctggttgtatggtgttcgatatgggactagctaccacgcccgcttgtttcatgagcacattgttgcctc 32875505  T
Q  201 catttgtctatg 212  Q
    ||||||||||||    
T  32875506 catttgtctatg 32875517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University