View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18251_low_15 (Length: 235)

Name: NF18251_low_15
Description: NF18251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18251_low_15
NF18251_low_15
[»] chr7 (1 HSPs)
chr7 (21-160)||(41864393-41864532)


Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 21 - 160
Target Start/End: Complemental strand, 41864532 - 41864393
Alignment:
Q  21 gtggtcaattgggtgaaatgagataaattgtgtttaaatcgtggaaaagatggtacagtggtttgtaaggactaaggtacgtcaatttaacatcatttta 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  41864532 gtggtcaattgggtgaaatgagataaattgtgtttaaatcgtggaaaagatggtacaggggtttgtaaggactaaggtacgtcaatttaacatcatttta 41864433  T
Q  121 ttaggtaaccaatattggaggttgagggaggatcaattgg 160  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  41864432 ttaggtaaccaatattggaggttgagggaggatcaattgg 41864393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University