View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18249_low_21 (Length: 240)

Name: NF18249_low_21
Description: NF18249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18249_low_21
NF18249_low_21
[»] chr1 (1 HSPs)
chr1 (1-138)||(48829907-48830042)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 48830042 - 48829907
Alignment:
Q  1 caaaacatgccctaaatatgaaattaaacnnnnnnnnnntaaataaatgattatcagaagctataatatacgcataccagttatattagaatctcttgga 100  Q
    |||||||||||||||||||||||||||||          ||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48830042 caaaacatgccctaaatatgaaattaaacaaaaaaaa--taaataaaaaattatcagaagctataatatacgcataccagttatattagaatctcttgga 48829945  T
Q  101 acatcaactaatagagcaggacctgcaaaattcatcac 138  Q
    ||||||||||||||||||||||||||||||||||||||    
T  48829944 acatcaactaatagagcaggacctgcaaaattcatcac 48829907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University