View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18247_low_19 (Length: 226)

Name: NF18247_low_19
Description: NF18247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18247_low_19
NF18247_low_19
[»] chr4 (1 HSPs)
chr4 (58-209)||(8737839-8737990)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 58 - 209
Target Start/End: Original strand, 8737839 - 8737990
Alignment:
Q  58 tcaacacataagaaaaacagcggcacacaacggtttataatagcttactatccaattgataactgcgtacggttccttctcttcatgataatttttcaac 157  Q
    |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  8737839 tcaacacagaagaaaaacagcggcacacaacggtttgtaatagcttactatccaattgataactgtgtacggttccttctcttcatgataatttttcaac 8737938  T
Q  158 tatgcaatcacattgaatacacaaacgtgtgagtatcttcttatgttcacat 209  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  8737939 tattcaatcacattgaatacacaaacgtgtgagtatcttcttatgttcacat 8737990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University