View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18244_high_28 (Length: 242)

Name: NF18244_high_28
Description: NF18244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18244_high_28
NF18244_high_28
[»] chr4 (1 HSPs)
chr4 (160-226)||(5796535-5796601)


Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 160 - 226
Target Start/End: Complemental strand, 5796601 - 5796535
Alignment:
Q  160 cttaacttaatatattgaataaattggtttatattgaaatttatttgatactatggatctgtgttgt 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5796601 cttaacttaatatattgaataaattggtttatattgaaatttatttgatactatggatctgtgttgt 5796535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University