View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18243_low_121 (Length: 243)

Name: NF18243_low_121
Description: NF18243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18243_low_121
NF18243_low_121
[»] chr5 (1 HSPs)
chr5 (22-130)||(12546735-12546843)


Alignment Details
Target: chr5 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 22 - 130
Target Start/End: Complemental strand, 12546843 - 12546735
Alignment:
Q  22 tgaaggttaacctatggttatcttgtaacaatgctcttttctactgtttcttaattgaattgaatatcattttcctaagatctttgttaataattgtcaa 121  Q
    |||||||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||    
T  12546843 tgaaggttaacccatggttatcttgtgacaatgctctgttctactgtttcttaattgaattgaatatcattttcctatgttctttgttaataattgtcaa 12546744  T
Q  122 ttttatttg 130  Q
    |||||||||    
T  12546743 ttttatttg 12546735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University