View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_low_30 (Length: 205)

Name: NF18240_low_30
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_low_30
NF18240_low_30
[»] chr5 (1 HSPs)
chr5 (15-193)||(2168278-2168456)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 193
Target Start/End: Complemental strand, 2168456 - 2168278
Alignment:
Q  15 aatcaatactcccaaactcaaattttagtttgatattcacttcatttttaatacatcaaataattcaacaagttaattatctaagcaagattcgaactaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  2168456 aatcaatactcccaaactcaaattttagtttgatattcacttcatttttaatatatcaaataattcaacaagttaattatctaagcaagattcgaactaa 2168357  T
Q  115 ttttgagttaaatagatcataataatcttggttatatatgcatatgtatttattttgtgatatgcacgttttcttttca 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2168356 ttttgagttaaatagatcataataatcttggttatatatgcatatgtatttattttgtgatatgcacgttttcttttca 2168278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University