View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_high_28 (Length: 222)

Name: NF18240_high_28
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_high_28
NF18240_high_28
[»] chr5 (1 HSPs)
chr5 (14-203)||(41109304-41109493)
[»] chr7 (2 HSPs)
chr7 (14-203)||(17166606-17166795)
chr7 (85-147)||(100443-100505)


Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 41109304 - 41109493
Alignment:
Q  14 cagagacgaagaaattggcaaaagtcgtaaatgcgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca 113  Q
    |||||||| |||| |||||| ||||||| | || |||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||    
T  41109304 cagagacggagaagttggcagaagtcgtgactgtgttgcgtggatgtgctcatcaatggtggttttgggggcaccaccatcatccacatgcaagttggca 41109403  T
Q  114 atcattcgtcactgcctttttgtggcgttttaaaccggaataccgagacgtcttgcctatacctgatgaagaataggagaatgatattca 203  Q
    |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||| ||||||||||    
T  41109404 atcattcgtcactgcctttttgtggcgttttaaaccagaatatcgagacgtcttgcctatacctgatgaagaagaggagcatgatattca 41109493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 17166795 - 17166606
Alignment:
Q  14 cagagacgaagaaattggcaaaagtcgtaaatgcgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca 113  Q
    |||||||| |||| |||||| ||||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17166795 cagagacggagaagttggcagaagtcgtgactgtgttgcgtggatgtgctcatcaatggtggttttggtggcaccaccgtcatccacatgcaagttggca 17166696  T
Q  114 atcattcgtcactgcctttttgtggcgttttaaaccggaataccgagacgtcttgcctatacctgatgaagaataggagaatgatattca 203  Q
    |||||||||||||||||||||||||| ||||||||| ||||| |||||| |||||||||||||||| |||||| ||||| ||||||||||    
T  17166695 atcattcgtcactgcctttttgtggcattttaaaccagaatatcgagacatcttgcctatacctgacgaagaagaggagcatgatattca 17166606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 85 - 147
Target Start/End: Original strand, 100443 - 100505
Alignment:
Q  85 caccaccgtcatccacatgcaagttggcaatcattcgtcactgcctttttgtggcgttttaaa 147  Q
    ||||||||||||||||||||||||||| || |||| |||  ||||||| ||||||||||||||    
T  100443 caccaccgtcatccacatgcaagttgggaaccatttgtcgatgcctttctgtggcgttttaaa 100505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University