View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18240_high_27 (Length: 226)

Name: NF18240_high_27
Description: NF18240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18240_high_27
NF18240_high_27
[»] chr8 (1 HSPs)
chr8 (14-212)||(31524749-31524947)


Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 212
Target Start/End: Original strand, 31524749 - 31524947
Alignment:
Q  14 atgaatgaaatagcttttggtttagaattaagtgaacaaagatttgtttgggtggtacgtgcgtgtgcgtccacaacagaagctgtggacgcagcttttt 113  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31524749 atgaatgaattagcttttggtttagaattaagtgaacaaagatttgtttgggtggtacgtgcgtgtgcgtccacaacagaagctgtggacgcagcttttt 31524848  T
Q  114 tcaccactggatccagtggtgacgggtttggcgatgaacttgatgatcaaataggtaagcacttacctgagaggtttgtagagagaattaagaataaga 212  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  31524849 tcaccactggatccggtggtgacgggtttggcgatgaacttgatgatcaaataggtaagcacttacctgaggggtttgtagagagaattaagaataaga 31524947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University