View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18236_low_28 (Length: 226)

Name: NF18236_low_28
Description: NF18236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18236_low_28
NF18236_low_28
[»] chr3 (3 HSPs)
chr3 (7-122)||(36314182-36314297)
chr3 (114-223)||(36314696-36314806)
chr3 (37-116)||(36337002-36337082)


Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 7 - 122
Target Start/End: Original strand, 36314182 - 36314297
Alignment:
Q  7 ggaagtcacccgtaacaccaccaacttgcggatgaaagtgttaacaatagtaaaagagaggatagttaaagaagaaaacggcggctagggttccaaacaa 106  Q
    ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36314182 ggaagtcacgcgtaacaccaccaacttgcggacgaaagtgttaacaatagtaaaagagaggatagttaaagaagaaaacggcggctagggttccaaacaa 36314281  T
Q  107 attatgaaatatttta 122  Q
    ||||||||||||||||    
T  36314282 attatgaaatatttta 36314297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 114 - 223
Target Start/End: Original strand, 36314696 - 36314806
Alignment:
Q  114 aatattttaataggggacgttcatcggatcgagtggtcccttcaatccgatcacccaacccaattcaat-tgcactttacaaatccaacccgaaccaacc 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||     
T  36314696 aatattttaataggggacgttcatcggatcgagtggtcccttcaatccgatcacccaacccaattcaatctgcactttacaaatccaacccgaaccaaca 36314795  T
Q  213 cattcgattcc 223  Q
    |||||||||||    
T  36314796 cattcgattcc 36314806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 116
Target Start/End: Original strand, 36337002 - 36337082
Alignment:
Q  37 gatgaaagtgt-taacaatagtaaaagagaggatagttaaagaagaaaacggcggctagggttccaaacaaattatgaaat 116  Q
    ||||||||||| | ||||||| |||||||   ||||| |||| |||| ||| ||||||||||||||||||| |||||||||    
T  36337002 gatgaaagtgtctgacaatagaaaaagagttaatagtgaaaggagaagacgacggctagggttccaaacaagttatgaaat 36337082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University