View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18232_high_29 (Length: 229)

Name: NF18232_high_29
Description: NF18232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18232_high_29
NF18232_high_29
[»] chr8 (1 HSPs)
chr8 (146-213)||(38821576-38821643)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 38821576 - 38821643
Alignment:
Q  146 ttagtacgtcttcaacaataaggttttaaatgttcatattattctataatttatttttgacagagtat 213  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  38821576 ttagtacgtcttcaacaatatggttttaaatgttcatattattctataatttatttttgacagagtat 38821643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University