View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18227_high_39 (Length: 241)

Name: NF18227_high_39
Description: NF18227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18227_high_39
NF18227_high_39
[»] chr7 (1 HSPs)
chr7 (14-158)||(37892071-37892215)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 37892215 - 37892071
Alignment:
Q  14 cagatctcaaagagataaatttcacttccaccccaccaccccagaagttaaaaagcaaatattaacacaagtttcataaaaaagacagaatttttaagct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37892215 cagatctcaaagagataaatttcacttccaccccaccaccccagaagttaaaaagcaaatattaacacaagtttcataaaaaagacagaatttttaagct 37892116  T
Q  114 ttttcagctgcaaaaactttgaaactgccctgaaccctctcaccc 158  Q
    |||||||||||||||||||||||||| ||||||||||||||||||    
T  37892115 ttttcagctgcaaaaactttgaaactaccctgaaccctctcaccc 37892071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University