View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18226_low_5 (Length: 438)

Name: NF18226_low_5
Description: NF18226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18226_low_5
NF18226_low_5
[»] chr7 (1 HSPs)
chr7 (1-136)||(41405329-41405462)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 2e-47; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 41405462 - 41405329
Alignment:
Q  1 taacctctaacaataacaggtgaggatctttttatttttcaaattaagcaaatgaaaggttttatttaaagagagagnnnnnnnnnncgagaaaaatagt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||    
T  41405462 taacctctaacaataacaggtgaggatctttttatttttcaaattaagcaaatgaaaggttttatttaaagagagag--aaaaaaaacgagaaaaatagt 41405365  T
Q  101 gatggtgagataatttggtgatggatcaactattta 136  Q
    ||||||||||||||||||||||| ||||||||||||    
T  41405364 gatggtgagataatttggtgatgaatcaactattta 41405329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University