View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18215_high_21 (Length: 235)

Name: NF18215_high_21
Description: NF18215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18215_high_21
NF18215_high_21
[»] chr2 (1 HSPs)
chr2 (13-221)||(22649427-22649631)
[»] chr4 (1 HSPs)
chr4 (38-98)||(22850004-22850064)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 22649427 - 22649631
Alignment:
Q  13 tgcactctcgttttgaaaatcgagctgttacattgtggcatcagagtatggtagtagatttacttcaagggctgtgagtcgggtgtcataagctgatcga 112  Q
    |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||    
T  22649427 tgcactctcgttttgaaaattgagctgttacattgtggcatcagagcatggtagtagatttacttcaaaggttgtgagtcgggtgtcataagctgatcga 22649526  T
Q  113 gattcgtgtctagtgggcataagtggttagtgtcttatgtgttgtgtgtcttgcttcgggtcaagcataatatgtttactctctaaactaatcctagatg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||  |||| | |||||||||| | ||||    
T  22649527 gattcgtgtctagtgggcataagtggttagtgtcttatgtgt--tgtgtcttgctttgggtcaagcataatatg--tactttgtaaactaatctttgatg 22649622  T
Q  213 tgaagcaat 221  Q
    |||||||||    
T  22649623 tgaagcaat 22649631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 98
Target Start/End: Original strand, 22850004 - 22850064
Alignment:
Q  38 tgttacattgtggcatcagagtatggtagtagatttacttcaagggctgtgagtcgggtgt 98  Q
    ||||||||||| | ||||||| ||| |||||||||||||| ||||| ||||| | ||||||    
T  22850004 tgttacattgtagtatcagagcatgatagtagatttacttgaagggttgtgaattgggtgt 22850064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University