View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18198_low_14 (Length: 299)

Name: NF18198_low_14
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18198_low_14
NF18198_low_14
[»] chr3 (1 HSPs)
chr3 (83-284)||(53032010-53032208)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 83 - 284
Target Start/End: Original strand, 53032010 - 53032208
Alignment:
Q  83 ctctctcattattaaattaaatttagaaatagtagaaagcaaaactagagatactataaagagggataagcaatgacacaaattgttattcacttttgga 182  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53032010 ctctctcattattaaattaaatttagaaatagtagaaagtaaaactagagatactataaagagggataagcaatgacacaaattgttattcacttttgga 53032109  T
Q  183 tattgggatttcaaagtgattgctgactctttgcttccttgttccgctttcttttcctcattattcccttttcacatcacttcattactactacatacat 282  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||   ||||||||||||||    
T  53032110 tattgggatttcaaagtgattgctgactctttgcttccttgttctgctttcttttcttcattattcccttttcacatcacttc---actactacatacat 53032206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University