View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18198_low_10 (Length: 319)

Name: NF18198_low_10
Description: NF18198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18198_low_10
NF18198_low_10
[»] chr1 (1 HSPs)
chr1 (1-303)||(32460809-32461111)


Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 32460809 - 32461111
Alignment:
Q  1 ataactaacttttatatctctaatatcaggaaccacagggaaatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtggcggcatacaat 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32460809 ataactagcttttatatctctaatatcaggaaccacagggaaatcgaaaggagtgatgcttactcatcgcaacttgacggcgacggtggcggcatacaat 32460908  T
Q  101 gccgttaggattccgacggcgagtcctgcggtgtgtttgttaacagtgccgtgttttcacgtgtacggttttacgtaccttttgaagggtgtggctatga 200  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32460909 gccgttaggattccgacggcgaatcctgcggtgtgtttgttaacagtgccgtgttttcacgtgtacggttttacgtaccttttgaagggtgtggctatga 32461008  T
Q  201 tggaaacggtggtgatgatggagaggtttgaattggggaaaatgttgggtgccgtggagaggtttagagtgactaatgttgcggtggcgccgcccgtggt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32461009 tggaaacggtggtgatgatggagaggtttgaattggggaaaatgttgggtgccgtggagaggtttagagtgactaatgttgcggtggcgccgcccgtggt 32461108  T
Q  301 ggt 303  Q
    |||    
T  32461109 ggt 32461111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University