View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18196_low_71 (Length: 203)

Name: NF18196_low_71
Description: NF18196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18196_low_71
NF18196_low_71
[»] chr1 (2 HSPs)
chr1 (21-186)||(16330730-16330896)
chr1 (24-64)||(16339915-16339955)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 1e-70; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 21 - 186
Target Start/End: Original strand, 16330730 - 16330896
Alignment:
Q  21 gtcgttacccccggtcactagcttatcactcaccagagggtccaaccaatatttattattcacatcgcttccatcctaggcttttgttatcacctttctc 120  Q
    ||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||    
T  16330730 gtcgttacccctggtcactagcttatcactcaccagagggtccaacgaatatttattattcacaccgcttccatcctaggctttagttatcacctttctc 16330829  T
Q  121 ttggtattccgaacatcaccaaaagtat-ttcattggggccatgcacctctttaacttaagaatatt 186  Q
    ||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||    
T  16330830 ttggtattccgaacatcaccaaaagtatcaccattggggccatgcacctctttaacttaagaatatt 16330896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 64
Target Start/End: Original strand, 16339915 - 16339955
Alignment:
Q  24 gttacccccggtcactagcttatcactcaccagagggtcca 64  Q
    |||||||||| |||||||||||||||| || ||||||||||    
T  16339915 gttacccccgatcactagcttatcacttactagagggtcca 16339955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University