View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18190_high_11 (Length: 237)

Name: NF18190_high_11
Description: NF18190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18190_high_11
NF18190_high_11
[»] chr5 (1 HSPs)
chr5 (155-221)||(19025199-19025266)
[»] chr8 (1 HSPs)
chr8 (4-47)||(22621832-22621875)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 221
Target Start/End: Complemental strand, 19025266 - 19025199
Alignment:
Q  155 gggccgttcacttgagagtgtttaattcttagtgacacgggaaattgctggtacat-attgtattttg 221  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19025266 gggctgttcacttgagagtgtttaattcttagtgacacgggaaattgctggtacatgattgtattttg 19025199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 22621875 - 22621832
Alignment:
Q  4 aaattgcagcaccttgtatttgtgcctcatggaattagttagtt 47  Q
    |||| |||||| |||||||||||||||||||| |||||||||||    
T  22621875 aaatagcagcagcttgtatttgtgcctcatggtattagttagtt 22621832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University