View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18182_high_13 (Length: 209)

Name: NF18182_high_13
Description: NF18182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18182_high_13
NF18182_high_13
[»] chr1 (1 HSPs)
chr1 (60-192)||(35918383-35918515)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 60 - 192
Target Start/End: Original strand, 35918383 - 35918515
Alignment:
Q  60 gttcatggcgcgaattcttctccctctcctccctctcccgtccctactcctacgacgacgcaatgctccgtctccgtcataacctaacctactttcaatt 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35918383 gttcatggcgcgaattcttctccctctcctccctctcccgtccctactcctacgacgacgcaatgctccgtctccgtcataacctaacctactttcaatt 35918482  T
Q  160 caactacaccaccacaatcctcctcatcgtctt 192  Q
    |||||||||||||||||||||||||||||||||    
T  35918483 caactacaccaccacaatcctcctcatcgtctt 35918515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University