View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18181_low_12 (Length: 221)

Name: NF18181_low_12
Description: NF18181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18181_low_12
NF18181_low_12
[»] chr5 (2 HSPs)
chr5 (22-95)||(10254659-10254732)
chr5 (22-87)||(10239873-10239938)


Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 22 - 95
Target Start/End: Complemental strand, 10254732 - 10254659
Alignment:
Q  22 tctatgaaggtgttgatgatgtcgtcaaatgtgttgaatagtagtgctgggagtgacgatgtttgtcgtttttt 95  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||    
T  10254732 tctatgaaggtgttgatgatgtcgtcgaatgtgttgaatagtagtgctgggagtgacgatgtttgtggtttttt 10254659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 87
Target Start/End: Original strand, 10239873 - 10239938
Alignment:
Q  22 tctatgaaggtgttgatgatgtcgtcaaatgtgttgaatagtagtgctgggagtgacgatgtttgt 87  Q
    ||||||||||||||||||||||| || | |||||||| || |||||||| || ||| |||||||||    
T  10239873 tctatgaaggtgttgatgatgtcatcgagtgtgttgagtattagtgctgagattgatgatgtttgt 10239938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University