View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18180_high_5 (Length: 263)

Name: NF18180_high_5
Description: NF18180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18180_high_5
NF18180_high_5
[»] chr2 (1 HSPs)
chr2 (16-246)||(36530582-36530812)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 36530582 - 36530812
Alignment:
Q  16 aattattgggttgatttgcttagctggaattgttggtatgtgacatgagaatttattcaattcaattacacatcattttaatcacgcttttggaaattga 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  36530582 aattattgggttgatttgcttagctggaattgttggtatgtgacatgagagtttattcaattcaattacacatcattttaatcacgcttttggaaattga 36530681  T
Q  116 aaccctagcccgtgttggtatcacggtgtgataccataatcacgtcgttgtgattatgacatatccaccgtgataccataccaagtttcaacatatgaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  36530682 aaccctagcccgtgttggtatcacggtgtgataccataatcacgtcgttgtgattatgacatatccaccttgataccataccaagtttcaacatatgaaa 36530781  T
Q  216 aatgaaaccacgtgttttgagcattgaaaat 246  Q
    |||||||||||||||||||||||||||||||    
T  36530782 aatgaaaccacgtgttttgagcattgaaaat 36530812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University