View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18178_low_132 (Length: 247)

Name: NF18178_low_132
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18178_low_132
NF18178_low_132
[»] chr2 (1 HSPs)
chr2 (13-146)||(14396279-14396411)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 14396279 - 14396411
Alignment:
Q  13 gaaaggaaacttgaattcttaacataaaatccaaacacatccaatagttgttgaacatgattaagatggagcttcagactaacagatagatgtcttgcca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14396279 gaaaggaaacttgaattcttaacataaaatccaaacacatccaatagttgttgaacatgattaagatggagcttcagactaacagatagatgtcttgcca 14396378  T
Q  113 caatgnnnnnnntggaatttggagagtaaatcag 146  Q
    |||||       ||||||||||||||||||||||    
T  14396379 caatg-aaaaaatggaatttggagagtaaatcag 14396411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University