View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18178_high_140 (Length: 237)

Name: NF18178_high_140
Description: NF18178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18178_high_140
NF18178_high_140
[»] chr4 (2 HSPs)
chr4 (143-219)||(49755076-49755152)
chr4 (55-114)||(49754939-49754998)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 143 - 219
Target Start/End: Original strand, 49755076 - 49755152
Alignment:
Q  143 aaacatgacatgagaatgtggcgatagcatgtattactcctcccttggctctcgtgtgattcgttaaatgagaatta 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49755076 aaacatgacatgagaatgtggcgatagcatgtattactcctcccttggctctcgtgtgattcgttaaatgagaatta 49755152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 55 - 114
Target Start/End: Original strand, 49754939 - 49754998
Alignment:
Q  55 taccgaattcatccctattggtcaacacataccaaactgtttctattgcaagaagcatat 114  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  49754939 taccgaattcatccctattggtcaacacatgccaaactgtttctattgcaagaagcatat 49754998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University