View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18176_low_31 (Length: 240)

Name: NF18176_low_31
Description: NF18176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18176_low_31
NF18176_low_31
[»] chr7 (3 HSPs)
chr7 (1-222)||(36998869-36999090)
chr7 (9-121)||(36994070-36994182)
chr7 (60-121)||(36988346-36988407)


Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36998869 - 36999090
Alignment:
Q  1 ccgccgcattgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctctttcttatgggttgccatctctttttgcacaggatcacg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36998869 ccgccgcattgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctctttcttatgggttgccatctctttttgcacaggatcacg 36998968  T
Q  101 tgttgttatcttctcagtctggagataaattagttcaacacatgttaggagcaaacaacacaaatgtgacccataactagcacattgaaagaagaaaaaa 200  Q
    || ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  36998969 tgctgtcatcttctcagtctggagataaattagttcaacacatgttaggaacaaacaacacaaatgtgacccataactagcacattgaaagaagaaaaaa 36999068  T
Q  201 gagttcttcaaaagtatactat 222  Q
    ||||||||||||||||||||||    
T  36999069 gagttcttcaaaagtatactat 36999090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 36994070 - 36994182
Alignment:
Q  9 ttgtgttcacgtgctgccagcttatctagctctgcctggttcatctttgcctctttcttatgggttgccatctctttttgcacaggatcacgtgttgtta 108  Q
    ||||||||||| || |||   ||||| ||||| |||||||| | | || | |||||||| |||||||||||||||||||||| ||||||| |||  || |    
T  36994070 ttgtgttcacgcgccgcctctttatcaagctcagcctggttaaccctttcttctttcttttgggttgccatctctttttgcaaaggatcatgtgccgtca 36994169  T
Q  109 tcttctcagtctg 121  Q
    ||||||| |||||    
T  36994170 tcttctctgtctg 36994182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 60 - 121
Target Start/End: Original strand, 36988346 - 36988407
Alignment:
Q  60 tctttcttatgggttgccatctctttttgcacaggatcacgtgttgttatcttctcagtctg 121  Q
    |||||||| |||||||||||||| ||||||| ||||||| |||  || |||||||| |||||    
T  36988346 tctttcttttgggttgccatctccttttgcaaaggatcatgtgccgtcatcttctctgtctg 36988407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University