View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18172_high_2 (Length: 382)

Name: NF18172_high_2
Description: NF18172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18172_high_2
NF18172_high_2
[»] chr5 (1 HSPs)
chr5 (1-96)||(39540208-39540303)
[»] chr3 (1 HSPs)
chr3 (217-303)||(437632-437718)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 39540303 - 39540208
Alignment:
Q  1 ttaggatatattttggaaaatgcttaatgtcacaaaacattatttcttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta 96  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39540303 ttaggatatattttggaaaatgcttaatgtcgcaaaacattatttcttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta 39540208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 217 - 303
Target Start/End: Original strand, 437632 - 437718
Alignment:
Q  217 gtttgtgccgagtcggagcgcgccgagtctctgagtttgattcggtttaaggatgatatgtattttccttcctactaaattgcattg 303  Q
    ||||||| ||||||||| || || ||||||| |||||| | |||||| |||||||| || ||||||||||||| |||||||||||||    
T  437632 gtttgtgtcgagtcggaacgtgctgagtctccgagtttcactcggttcaaggatgagatctattttccttcctcctaaattgcattg 437718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University