View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18168_low_32 (Length: 244)

Name: NF18168_low_32
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18168_low_32
NF18168_low_32
[»] scaffold0280 (1 HSPs)
scaffold0280 (16-150)||(1466-1600)
[»] chr7 (1 HSPs)
chr7 (80-137)||(5529551-5529608)


Alignment Details
Target: scaffold0280 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0280
Description:

Target: scaffold0280; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 1466 - 1600
Alignment:
Q  16 atgtgttgtgattgatatcgaaagcatttgttgatcgtcatacgatcccccnnnnnnnnnctacaaagcaatttcagggatcatatgaacagttggcagc 115  Q
    ||||||||||||||||||| |||| ||||||||| ||||||||||||||||         ||||||||| | ||||||||||||||||||||||||||||    
T  1466 atgtgttgtgattgatatcaaaagtatttgttgaccgtcatacgatcccccaaaaaaaaactacaaagcgaattcagggatcatatgaacagttggcagc 1565  T
Q  116 gaccatgatatcataattcattaaacacccctaac 150  Q
    ||||||||||||||||||||| |||||||||||||    
T  1566 gaccatgatatcataattcataaaacacccctaac 1600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 80 - 137
Target Start/End: Original strand, 5529551 - 5529608
Alignment:
Q  80 aaagcaatttcagggatcatatgaacagttggcagcgaccatgatatcataattcatt 137  Q
    |||| |||||||||||||||||||| |||  |||| || ||||||||||||| |||||    
T  5529551 aaagaaatttcagggatcatatgaatagtcagcagtgatcatgatatcataaatcatt 5529608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University