View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18162_low_31 (Length: 291)

Name: NF18162_low_31
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18162_low_31
NF18162_low_31
[»] chr5 (2 HSPs)
chr5 (186-273)||(5791897-5791985)
chr5 (10-49)||(5792119-5792158)


Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 5791985 - 5791897
Alignment:
Q  186 ggtaactaaaatttgatttcgtttgnnnnnnncata-ttttcttcaaacatatcaataataacagttttgaacaattcaattcggtttg 273  Q
    ||||||||||||| |||||||||||       |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  5791985 ggtaactaaaattcgatttcgtttgtttttttcatattttttttcaaacatatcaataataacagttttgaacaattcaattcggtttg 5791897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 49
Target Start/End: Complemental strand, 5792158 - 5792119
Alignment:
Q  10 attatacttcacatcacatgacatgattacctgggtggat 49  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  5792158 attatacttcacatcacatgacatgattacctgggtggat 5792119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University