View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18161_low_57 (Length: 201)

Name: NF18161_low_57
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18161_low_57
NF18161_low_57
[»] chr2 (2 HSPs)
chr2 (24-111)||(43993611-43993698)
chr2 (149-185)||(43993511-43993547)


Alignment Details
Target: chr2 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 24 - 111
Target Start/End: Complemental strand, 43993698 - 43993611
Alignment:
Q  24 ttaacaaattacatcaccgaaattttaagttaattgaataaattaagcagtgattaaattcaaacaaatcgaaatgggaatgtttcaa 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  43993698 ttaacaaattacatcaccgaaattttaagttaattgaataaattaagcagtgtttaaattcaaacaaatcgaaatgggaatgtttcaa 43993611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 43993547 - 43993511
Alignment:
Q  149 ccatttcttttttgagttgacaacgtggaggaagatg 185  Q
    |||||||||||||||||||||||||||||||||||||    
T  43993547 ccatttcttttttgagttgacaacgtggaggaagatg 43993511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University