View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18161_low_24 (Length: 369)

Name: NF18161_low_24
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18161_low_24
NF18161_low_24
[»] chr5 (1 HSPs)
chr5 (11-145)||(33442058-33442192)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 11 - 145
Target Start/End: Complemental strand, 33442192 - 33442058
Alignment:
Q  11 gatgaagaccattgaaaagttgacgcagaaagggtggaggttcaatcatataaggcaaagttatctttcccttcatacaacacatagaaacatcacggga 110  Q
    ||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||    
T  33442192 gatgaagaccattgaaaagttgacggagcaagggaggaggttcaatcatataaggcaaagttatctttcccttcatacaacacattgaaacatcatggga 33442093  T
Q  111 cagagtagtagaatcactgtgtgagcgctcgcgaa 145  Q
    || ||||| ||| || ||  |||||||||||||||    
T  33442092 caaagtagaagagtccctacgtgagcgctcgcgaa 33442058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University