View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18157_low_54 (Length: 221)

Name: NF18157_low_54
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18157_low_54
NF18157_low_54
[»] chr1 (1 HSPs)
chr1 (20-207)||(4660645-4660832)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 4660832 - 4660645
Alignment:
Q  20 tgggacaggtgtcaataaagtagttataaaattgatatgtgtggtctgtactttgaacaagatatatcaatttttatcgacttaaatgtctctgataaat 119  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||    
T  4660832 tgggaaaggtgtcaataaagtagttataaaattgatatgtgtggtctgtattttgaacaagatatatcaatttttatcaacttaaatgtctctgataaat 4660733  T
Q  120 aagatcaaaaggagtatttaattcggactcattgagtatgtatgttgaactatgatcctcttcagttatcaaaataattagacgatat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||    
T  4660732 aagatcaaaaggagtatttaattcggactcattgagtatgtatgttgaactacgatcctcttcatttatcaaaataattatacgatat 4660645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University