View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18157_high_48 (Length: 205)

Name: NF18157_high_48
Description: NF18157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18157_high_48
NF18157_high_48
[»] chr6 (1 HSPs)
chr6 (22-145)||(294339-294462)


Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 22 - 145
Target Start/End: Original strand, 294339 - 294462
Alignment:
Q  22 acgaacaatttgaccgaattaaaactttacggatgaaagacatttggcaaaaatttaaatggttgagattacagaaagcaaacacatcatttttgttact 121  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||    
T  294339 acgaacaatttgaccgaattaaaactttacggatgaaagacatgtggccaaaatttgaatggttgagattaaagaaagcaaacacatcatttttgttact 294438  T
Q  122 aacaaaacacaacccctacgaacc 145  Q
    ||||||||| ||||||||||||||    
T  294439 aacaaaacataacccctacgaacc 294462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University