View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18156_high_62 (Length: 234)

Name: NF18156_high_62
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18156_high_62
NF18156_high_62
[»] chr8 (1 HSPs)
chr8 (43-183)||(7375073-7375213)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 43 - 183
Target Start/End: Complemental strand, 7375213 - 7375073
Alignment:
Q  43 tacgtaaaaattgctcagtatacgccacaccagcacattaaatgataaaccggtgaaaaaatataattaattttgttagttttataaaaattatgacata 142  Q
    |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  7375213 tacgtaaaaattgctcagtatacgccactccagcacattaaataataaaccggtgaaaaaatataattaattttgttagttttataaaagttatgacata 7375114  T
Q  143 cttaacaaaattaatttttcactaacaatatgtgaaagaaa 183  Q
    |||||||||||||||||||||||||| ||||||||||||||    
T  7375113 cttaacaaaattaatttttcactaacgatatgtgaaagaaa 7375073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University